Transcript: Human NM_001321449.1

Homo sapiens IZUMO family member 2 (IZUMO2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
IZUMO2 (126123)
Length:
959
CDS:
88..828

Additional Resources:

NCBI RefSeq record:
NM_001321449.1
NBCI Gene record:
IZUMO2 (126123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135404 GTACCAGATGGACAGCAAATA pLKO.1 612 CDS 100% 0.000 0.000 N IZUMO2 n/a
2 TRCN0000136824 CCAAACTTTGCCGCTTGCTAA pLKO.1 491 CDS 100% 4.950 3.960 N IZUMO2 n/a
3 TRCN0000137316 GAGGATCACTCCCAAGTGTAT pLKO.1 543 CDS 100% 4.950 3.465 N IZUMO2 n/a
4 TRCN0000135572 GACAAATCAACTGGACCTTGT pLKO.1 321 CDS 100% 4.050 2.835 N IZUMO2 n/a
5 TRCN0000135796 CATCCTCATTTCTGTGTCTCT pLKO.1 657 CDS 100% 2.640 1.848 N IZUMO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13114 pDONR223 100% 61.8% 63% None (many diffs) n/a
2 ccsbBroad304_13114 pLX_304 0% 61.8% 63% V5 (many diffs) n/a
3 TRCN0000469782 CTCACGCGATGCTTAGCCGCCAGA pLX_317 69.9% 61.8% 63% V5 (many diffs) n/a
4 ccsbBroadEn_10792 pDONR223 100% 11.1% 3.2% None (many diffs) n/a
5 ccsbBroad304_10792 pLX_304 0% 11.1% 3.2% V5 (many diffs) n/a
6 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 11.1% 3.2% V5 (many diffs) n/a
7 ccsbBroadEn_13781 pDONR223 100% 10.5% .9% None (many diffs) n/a
8 ccsbBroad304_13781 pLX_304 0% 10.5% .9% V5 (many diffs) n/a
9 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 10.5% .9% V5 (many diffs) n/a
Download CSV