Transcript: Human NM_001321829.1

Homo sapiens coiled-coil domain containing 186 (CCDC186), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CCDC186 (55088)
Length:
7386
CDS:
393..3089

Additional Resources:

NCBI RefSeq record:
NM_001321829.1
NBCI Gene record:
CCDC186 (55088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173167 CGAGAAGAATCAGGCACACTT pLKO.1 2808 CDS 100% 4.950 3.960 N Ccdc186 n/a
2 TRCN0000122252 CCTGTCATTGAATCTAAACAA pLKO.1 3315 3UTR 100% 5.625 3.938 N CCDC186 n/a
3 TRCN0000121939 CAGAAGTTAAAGCATTGAGTA pLKO.1 2383 CDS 100% 4.950 3.465 N CCDC186 n/a
4 TRCN0000121657 GAACAGAAATAGAACGTCTTA pLKO.1 3025 CDS 100% 4.950 3.465 N CCDC186 n/a
5 TRCN0000122439 GAGAAGAATCAGGCACACTTT pLKO.1 2809 CDS 100% 4.950 3.465 N CCDC186 n/a
6 TRCN0000121828 GCAGCATATGAACACAATTAA pLKO.1 1127 CDS 100% 0.000 0.000 N CCDC186 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4101 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4102 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03519 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03519 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473338 TTTTCCTGATGTTTTGTGGGTGTG pLX_317 18.6% 100% 100% V5 n/a
4 ccsbBroadEn_15886 pDONR223 0% 23.4% 23.4% None 120T>C;634_2694del n/a
5 ccsbBroad304_15886 pLX_304 0% 23.4% 23.4% V5 120T>C;634_2694del n/a
6 TRCN0000471301 TTCTACGAGTCTAGTGTCTACCCC pLX_317 75.3% 23.4% 23.4% V5 120T>C;634_2694del n/a
Download CSV