Transcript: Human NM_001321866.2

Homo sapiens zinc finger protein 600 (ZNF600), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ZNF600 (162966)
Length:
4618
CDS:
840..3215

Additional Resources:

NCBI RefSeq record:
NM_001321866.2
NBCI Gene record:
ZNF600 (162966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321866.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426370 TAGACTTCACACTGCAGTAAA pLKO_005 1757 CDS 100% 13.200 9.240 N ZNF600 n/a
2 TRCN0000424087 TCTCAGCTGGCAAGACATAAA pLKO_005 2073 CDS 100% 13.200 9.240 N ZNF600 n/a
3 TRCN0000433089 ACAACTTTCACTTCATCATAG pLKO_005 2915 CDS 100% 10.800 7.560 N ZNF600 n/a
4 TRCN0000417191 ACCTTCCGTCTGAGGTCATAC pLKO_005 2562 CDS 100% 10.800 7.560 N ZNF600 n/a
5 TRCN0000018106 CCTGGAAAGAAACCATACAAA pLKO.1 3027 CDS 100% 5.625 3.938 N ZNF600 n/a
6 TRCN0000018103 CCTGGTAAGACATACTAGAAT pLKO.1 2246 CDS 100% 5.625 3.938 N ZNF600 n/a
7 TRCN0000018104 CATCCCAAAGAATTTCTCCTA pLKO.1 1414 CDS 100% 2.640 1.848 N ZNF600 n/a
8 TRCN0000436031 ATCAACCCTTGAGTCACATAA pLKO_005 1988 CDS 100% 13.200 7.920 N ZNF600 n/a
9 TRCN0000018105 CCGGAGAGAAACCATACAAAT pLKO.1 2440 CDS 100% 13.200 7.920 N ZNF600 n/a
10 TRCN0000018107 GCTGGAAACAAGCCTATTAAA pLKO.1 1278 CDS 100% 15.000 7.500 Y ZNF600 n/a
11 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 1957 CDS 100% 5.625 2.813 Y ZNF702P n/a
12 TRCN0000146631 CCTCATTAGACATCAGAGAAT pLKO.1 3506 3UTR 100% 4.950 2.475 Y ZNF816 n/a
13 TRCN0000148019 GCAAAGCCTTTACTTCATGTT pLKO.1 3481 3UTR 100% 4.950 2.475 Y ZNF816 n/a
14 TRCN0000142662 GCAAGGCAATACAGAAGTGAT pLKO.1 1073 CDS 100% 4.950 2.475 Y ZNF468 n/a
15 TRCN0000148307 CAATGTAATGAGAGTGGCAAA pLKO.1 1533 CDS 100% 4.050 2.025 Y ZNF321P n/a
16 TRCN0000142203 GCAGTGAGTATAGCAAACCAT pLKO.1 3637 3UTR 100% 3.000 1.500 Y ZNF468 n/a
17 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 2461 CDS 100% 2.640 1.320 Y ZNF468 n/a
18 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1941 CDS 100% 4.950 2.475 Y ZNF28 n/a
19 TRCN0000148611 CGTAGACTTCATACTGGAGAA pLKO.1 2763 CDS 100% 4.050 2.025 Y ZNF761 n/a
20 TRCN0000149655 GCCCTTGTAATTCATAAGGCT pLKO.1 1824 CDS 100% 0.750 0.375 Y ZNF813 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321866.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05629 pDONR223 100% 18.1% 14.6% None (many diffs) n/a
2 ccsbBroad304_05629 pLX_304 0% 18.1% 14.6% V5 (many diffs) n/a
3 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 18.1% 14.6% V5 (many diffs) n/a
Download CSV