Transcript: Human NM_001322198.1

Homo sapiens Janus kinase 2 (JAK2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
JAK2 (3717)
Length:
5205
CDS:
1630..3813

Additional Resources:

NCBI RefSeq record:
NM_001322198.1
NBCI Gene record:
JAK2 (3717)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146541 TCTTCAGGAGAGAATACCAT pXPR_003 GGG 934 43% 17 0.7595 JAK2 JAK2 75726
2 BRDN0001147052 AATGAAGAGTACAACCTCAG pXPR_003 TGG 176 8% 11 -0.0182 JAK2 JAK2 75727
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197230 GCCATCATACGAGATCTTAAC pLKO.1 2812 CDS 100% 10.800 15.120 N JAK2 n/a
2 TRCN0000196855 GCGGAATTTATGCGTATGATT pLKO.1 3589 CDS 100% 5.625 7.875 N JAK2 n/a
3 TRCN0000196656 GCCAATAACATTCTTCGATCT pLKO.1 4693 3UTR 100% 4.050 5.670 N JAK2 n/a
4 TRCN0000003180 GCTTTGTCTTTCGTGTCATTA pLKO.1 1498 5UTR 100% 13.200 10.560 N JAK2 n/a
5 TRCN0000315247 GCTTTGTCTTTCGTGTCATTA pLKO_005 1498 5UTR 100% 13.200 10.560 N JAK2 n/a
6 TRCN0000381098 GCAACTTGGCAAGGGTAATTT pLKO_005 2973 CDS 100% 15.000 10.500 N JAK2 n/a
7 TRCN0000382030 AGTGATCCTGGCATTAGTATT pLKO_005 2506 CDS 100% 13.200 9.240 N JAK2 n/a
8 TRCN0000003181 GCAGAATTAGCAAACCTTATA pLKO.1 2746 CDS 100% 13.200 9.240 N JAK2 n/a
9 TRCN0000315179 GCAGAATTAGCAAACCTTATA pLKO_005 2746 CDS 100% 13.200 9.240 N JAK2 n/a
10 TRCN0000195721 CGCAGATTTATTCAGCAATTC pLKO.1 1209 5UTR 100% 10.800 7.560 N JAK2 n/a
11 TRCN0000003178 CCCTGACCCTAAATAATACAT pLKO.1 4484 3UTR 100% 5.625 3.938 N JAK2 n/a
12 TRCN0000315249 CCCTGACCCTAAATAATACAT pLKO_005 4484 3UTR 100% 5.625 3.938 N JAK2 n/a
13 TRCN0000003179 CACAGTTTGAAGAGAGACATT pLKO.1 2939 CDS 100% 4.950 3.465 N JAK2 n/a
14 TRCN0000350495 CACAGTTTGAAGAGAGACATT pLKO_005 2939 CDS 100% 4.950 3.465 N JAK2 n/a
15 TRCN0000003177 CAGTGTTAGATATGATGAGAA pLKO.1 1054 5UTR 100% 4.950 3.465 N JAK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10929 pDONR223 100% 64.3% 64.3% None 0_1ins1206;1275G>A n/a
2 ccsbBroad304_10929 pLX_304 0% 64.3% 64.3% V5 0_1ins1206;1275G>A n/a
3 ccsbBroadEn_14680 pDONR223 0% 64.2% 64.2% None 0_1ins1215 n/a
4 TRCN0000472785 CCCCCACGAGTCAAACATTTAGTC pLX_317 12.6% 64.1% 64.2% V5 (not translated due to prior stop codon) 0_1ins1215;2181_2182insTGA n/a
5 ccsbBroad304_14680 pLX_304 14.6% 61.2% 50.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488199 AACGTGGACCCGTCCGTGGCAGGT pLX_317 8.7% 64.1% 64.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV