Transcript: Human NM_001323913.2

Homo sapiens GA binding protein transcription factor subunit beta 2 (GABPB2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GABPB2 (126626)
Length:
8639
CDS:
175..1353

Additional Resources:

NCBI RefSeq record:
NM_001323913.2
NBCI Gene record:
GABPB2 (126626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431255 ATCGAGATGTCGTAGAGTTAC pLKO_005 353 CDS 100% 10.800 15.120 N GABPB2 n/a
2 TRCN0000421467 TATGCAAGGGCCACAATTTGC pLKO_005 1354 CDS 100% 4.950 6.930 N GABPB2 n/a
3 TRCN0000005658 CCTTAGATTTATGATGCGTAT pLKO.1 1755 3UTR 100% 4.050 5.670 N GABPB2 n/a
4 TRCN0000005660 GCCTCACACTAGAGTTTCCAT pLKO.1 1314 CDS 100% 3.000 4.200 N GABPB2 n/a
5 TRCN0000428565 TTAACCTCGCAAGCCTTATTT pLKO_005 581 CDS 100% 15.000 12.000 N GABPB2 n/a
6 TRCN0000005661 GCAGCCCAATGGAGTTGATTT pLKO.1 1191 CDS 100% 13.200 9.240 N GABPB2 n/a
7 TRCN0000435840 GAGAAGTTGCCACTAACAAAG pLKO_005 988 CDS 100% 10.800 7.560 N GABPB2 n/a
8 TRCN0000010959 GCAATGCAGAATCAGGTGAAT pLKO.1 481 CDS 100% 4.950 3.465 N GABPB2 n/a
9 TRCN0000005659 GCCAAGATGATGAAGTGAGAA pLKO.1 224 CDS 100% 4.950 3.465 N GABPB2 n/a
10 TRCN0000418163 ATTTGCACTGTGTTCATATTA pLKO_005 1369 3UTR 100% 15.000 9.000 N GABPB2 n/a
11 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 2443 3UTR 100% 4.950 2.475 Y GJD4 n/a
12 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 2443 3UTR 100% 4.950 2.475 Y C9orf85 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2574 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 6742 3UTR 100% 4.050 2.025 Y LOC441087 n/a
15 TRCN0000055014 GCCAGCCATTTATTGTAACTA pLKO.1 890 CDS 100% 5.625 3.938 N Gabpb2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2575 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2738 3UTR 100% 10.800 5.400 Y SMIM11A n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7501 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7501 3UTR 100% 5.625 2.813 Y EID2B n/a
20 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2922 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04817 pDONR223 100% 87.5% 87.5% None 106_107ins168 n/a
2 ccsbBroad304_04817 pLX_304 0% 87.5% 87.5% V5 106_107ins168 n/a
3 TRCN0000467065 CAGCGACGATACGTCTCCGCGCAG pLX_317 30.4% 87.5% 87.5% V5 106_107ins168 n/a
Download CSV