Transcript: Human NM_001329191.1

Homo sapiens relaxin 2 (RLN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
RLN2 (6019)
Length:
619
CDS:
77..379

Additional Resources:

NCBI RefSeq record:
NM_001329191.1
NBCI Gene record:
RLN2 (6019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435586 ATTGTGCACATCTCGTATAAT pLKO_005 390 3UTR 100% 15.000 7.500 Y RLN2 n/a
2 TRCN0000433333 TACAGTGCATTGGCTAATAAA pLKO_005 311 CDS 100% 15.000 7.500 Y RLN2 n/a
3 TRCN0000120356 CCATCCTTCATCAACAAAGAT pLKO.1 41 5UTR 100% 5.625 2.813 Y Rln1 n/a
4 TRCN0000146706 CCATCCTTCATCAACAAAGAT pLKO.1 41 5UTR 100% 5.625 2.813 Y RLN2 n/a
5 TRCN0000150355 CCATCCTTCATCAACAAAGAT pLKO.1 41 5UTR 100% 5.625 2.813 Y RLN1 n/a
6 TRCN0000149368 GTGCCATCCTTCATCAACAAA pLKO.1 38 5UTR 100% 5.625 2.813 Y RLN2 n/a
7 TRCN0000148973 GCATTACCACAGCTACAACAA pLKO.1 143 CDS 100% 4.950 2.475 Y RLN2 n/a
8 TRCN0000149932 GCCATCCTTCATCAACAAAGA pLKO.1 40 5UTR 100% 4.950 2.475 Y RLN2 n/a
9 TRCN0000151299 GATGAAGCTAATTGTGCACAT pLKO.1 380 CDS 100% 4.050 2.025 Y RLN1 n/a
10 TRCN0000149344 GCTTGGATACTCATTCTCGAA pLKO.1 276 CDS 100% 2.640 1.320 Y RLN2 n/a
11 TRCN0000152386 GAAGCTAATTGTGCACATCTT pLKO.1 383 3UTR 100% 4.950 2.475 Y RLN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01403 pDONR223 100% 54% 54% None 0_1ins255 n/a
2 ccsbBroad304_01403 pLX_304 0% 54% 54% V5 0_1ins255 n/a
3 TRCN0000471158 CCTACATTAGCGGATGTTGTTCTG pLX_317 84.2% 54% 54% V5 0_1ins255 n/a
4 ccsbBroadEn_01399 pDONR223 100% 46.9% 41% None (many diffs) n/a
5 TRCN0000466101 TAATCCGTTCGAACCTTCCAGGAA pLX_317 59.8% 46.9% 41% V5 (many diffs) n/a
Download CSV