Transcript: Human NM_001329787.1

Homo sapiens 3-hydroxyacyl-CoA dehydratase 2 (HACD2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
HACD2 (201562)
Length:
4166
CDS:
395..826

Additional Resources:

NCBI RefSeq record:
NM_001329787.1
NBCI Gene record:
HACD2 (201562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370969 TGATCTCCTACATTCCAATTT pLKO_005 726 CDS 100% 13.200 18.480 N HACD2 n/a
2 TRCN0000159059 GCTTGCAGTATAGTTATGTTT pLKO.1 1209 3UTR 100% 5.625 7.875 N HACD2 n/a
3 TRCN0000161939 GATCACGGAAATCATCCGTTA pLKO.1 487 CDS 100% 0.405 0.567 N HACD2 n/a
4 TRCN0000166515 CGGAAATCATCCGTTACTCCT pLKO.1 492 CDS 100% 2.640 2.112 N HACD2 n/a
5 TRCN0000370970 AGGAGAACTGCTCACAATATA pLKO_005 604 CDS 100% 15.000 10.500 N HACD2 n/a
6 TRCN0000030088 GCTACCATAGCCTTTATTATT pLKO.1 267 5UTR 100% 15.000 10.500 N Hacd2 n/a
7 TRCN0000365688 CAGACAAGCTGGCCTATATTC pLKO_005 643 CDS 100% 13.200 9.240 N HACD2 n/a
8 TRCN0000365689 CTATGCATTCCTGATTCTAAT pLKO_005 703 CDS 100% 13.200 9.240 N HACD2 n/a
9 TRCN0000377614 ACACCCTGGCCAGTTCATTTC pLKO_005 1019 3UTR 100% 10.800 7.560 N HACD2 n/a
10 TRCN0000376663 GCATGGACGATCACGGAAATC pLKO_005 479 CDS 100% 10.800 7.560 N HACD2 n/a
11 TRCN0000160315 CCAGTTATACTTCCACATGAT pLKO.1 751 CDS 100% 4.950 3.465 N HACD2 n/a
12 TRCN0000160585 CTATAGGAATTGTTCCATCTT pLKO.1 348 5UTR 100% 4.950 3.465 N HACD2 n/a
13 TRCN0000030085 CCTGACTTCTTTCCAGGTGAT pLKO.1 376 5UTR 100% 4.050 2.835 N Hacd2 n/a
14 TRCN0000159607 GTCTATTAAACCATCTGCCTT pLKO.1 525 CDS 100% 2.640 1.848 N HACD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05198 pDONR223 100% 56.2% 56.2% None 0_1ins333 n/a
2 ccsbBroad304_05198 pLX_304 0% 56.2% 56.2% V5 0_1ins333 n/a
3 TRCN0000466043 TCTCGACATAGAGGAGGGGCTGAC pLX_317 47.3% 56.2% 56.2% V5 0_1ins333 n/a
Download CSV