Transcript: Human NM_001329904.1

Homo sapiens serpin family F member 1 (SERPINF1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
SERPINF1 (5176)
Length:
1490
CDS:
667..1362

Additional Resources:

NCBI RefSeq record:
NM_001329904.1
NBCI Gene record:
SERPINF1 (5176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052293 CCCAAGCTGAAGCTGAGTTAT pLKO.1 1048 CDS 100% 13.200 9.240 N SERPINF1 n/a
2 TRCN0000290158 CCCAAGCTGAAGCTGAGTTAT pLKO_005 1048 CDS 100% 13.200 9.240 N SERPINF1 n/a
3 TRCN0000296591 CCGAGTTCATTCATGACATAG pLKO_005 989 CDS 100% 10.800 7.560 N SERPINF1 n/a
4 TRCN0000052295 CCGGATCGTCTTTGAGAAGAA pLKO.1 525 5UTR 100% 4.950 3.465 N SERPINF1 n/a
5 TRCN0000290157 CCGGATCGTCTTTGAGAAGAA pLKO_005 525 5UTR 100% 4.950 3.465 N SERPINF1 n/a
6 TRCN0000052294 CGGAAGCATGAGTATCATCTT pLKO.1 912 CDS 100% 4.950 3.465 N SERPINF1 n/a
7 TRCN0000290232 CGGAAGCATGAGTATCATCTT pLKO_005 912 CDS 100% 4.950 3.465 N SERPINF1 n/a
8 TRCN0000052297 CTTGTTTGATTCACCAGACTT pLKO.1 1113 CDS 100% 4.950 3.465 N SERPINF1 n/a
9 TRCN0000052296 GCAGCGAACAGAATCCATCAT pLKO.1 396 5UTR 100% 4.950 3.465 N SERPINF1 n/a
10 TRCN0000174214 GCAGCGAACAGAATCCATCAT pLKO.1 396 5UTR 100% 4.950 3.465 N SERPINF1 n/a
11 TRCN0000290233 GCAGCGAACAGAATCCATCAT pLKO_005 396 5UTR 100% 4.950 3.465 N SERPINF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15521 pDONR223 0% 55.1% 55.2% None 0_1ins561;402T>C n/a
2 ccsbBroad304_15521 pLX_304 0% 55.1% 55.2% V5 0_1ins561;402T>C n/a
3 TRCN0000466286 TGCTGCTAACGTGGTAAGAACGAG pLX_317 30% 55.1% 55.2% V5 0_1ins561;402T>C n/a
4 ccsbBroadEn_06710 pDONR223 100% 55.1% 55.2% None 0_1ins561;402T>C n/a
5 ccsbBroad304_06710 pLX_304 0% 55.1% 55.2% V5 0_1ins561;402T>C n/a
6 TRCN0000474610 ATAAAACGCCTACGGAACGTTAGC pLX_317 33.5% 55.1% 55.2% V5 0_1ins561;402T>C n/a
Download CSV