Transcript: Human NM_001329924.2

Homo sapiens calmodulin 3 (CALM3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CALM3 (808)
Length:
2182
CDS:
212..553

Additional Resources:

NCBI RefSeq record:
NM_001329924.2
NBCI Gene record:
CALM3 (808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037899 CGAGAGGCGTTCCGTGTCTTT pLKO.1 362 CDS 100% 1.650 2.310 N CALM3 n/a
2 TRCN0000199119 CGTCACGTAATGACGAACCTG pLKO.1 422 CDS 100% 0.264 0.370 N CALM3 n/a
3 TRCN0000195104 CAAGGCCTGATGCATTCATAA pLKO.1 798 3UTR 100% 13.200 9.240 N CALM3 n/a
4 TRCN0000308194 CAAGGCCTGATGCATTCATAA pLKO_005 798 3UTR 100% 13.200 9.240 N CALM3 n/a
5 TRCN0000199369 CTGACCATGATGGCCAGAAAG pLKO.1 311 CDS 100% 10.800 7.560 N CALM3 n/a
6 TRCN0000025544 CCAGGTCAATTATGAAGAGTT pLKO.1 508 CDS 100% 4.950 3.465 N Calm3 n/a
7 TRCN0000037900 ACAAGGATGGAGATGGCACTA pLKO.1 165 5UTR 100% 4.050 2.835 N CALM3 n/a
8 TRCN0000289656 ACAAGGATGGAGATGGCACTA pLKO_005 165 5UTR 100% 4.050 2.835 N CALM3 n/a
9 TRCN0000037901 GCCAGGTCAATTATGAAGAGT pLKO.1 507 CDS 100% 3.000 2.100 N CALM3 n/a
10 TRCN0000289655 GCCAGGTCAATTATGAAGAGT pLKO_005 507 CDS 100% 3.000 2.100 N CALM3 n/a
11 TRCN0000199911 GTGGATGAGATGATCAGGGAG pLKO.1 467 CDS 100% 2.160 1.512 N CALM3 n/a
12 TRCN0000308197 GTGGATGAGATGATCAGGGAG pLKO_005 467 CDS 100% 2.160 1.512 N CALM3 n/a
13 TRCN0000196624 GAAGAGTTTGTACAGATGATG pLKO.1 521 CDS 100% 4.950 2.970 N CALM3 n/a
14 TRCN0000195538 CCAGAAAGATGAAGGACACAG pLKO.1 324 CDS 100% 4.050 2.430 N CALM3 n/a
15 TRCN0000025546 GTCTTTGACAAGGATGGGAAT pLKO.1 377 CDS 100% 4.050 2.430 N Calm3 n/a
16 TRCN0000037903 CTGACCGATGAGGAGGTGGAT pLKO.1 452 CDS 100% 0.880 0.528 N CALM3 n/a
17 TRCN0000196417 GTACAGATGATGACTGCAAAG pLKO.1 530 CDS 100% 6.000 3.000 Y CALM3 n/a
18 TRCN0000308195 GTACAGATGATGACTGCAAAG pLKO_005 530 CDS 100% 6.000 3.000 Y CALM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15372 pDONR223 0% 81.4% 100% None (many diffs) n/a
2 ccsbBroadEn_13821 pDONR223 100% 81.4% 95.5% None (many diffs) n/a
3 ccsbBroad304_13821 pLX_304 0% 81.4% 95.5% V5 (not translated due to frame shift) (many diffs) n/a
4 TRCN0000470188 ACTCTAACATCACAACCATTCACC pLX_317 100% 81.4% 95.5% V5 (not translated due to frame shift) (many diffs) n/a
5 ccsbBroadEn_00208 pDONR223 100% 75.8% 75.8% None 0_1ins108 n/a
6 ccsbBroad304_00208 pLX_304 0% 75.8% 75.8% V5 0_1ins108 n/a
7 TRCN0000469481 ATCTGGCTTATGCACTTAGGCCTT pLX_317 72.8% 75.8% 75.8% V5 0_1ins108 n/a
8 ccsbBroadEn_14560 pDONR223 0% 75.8% 75.8% None 0_1ins108 n/a
9 ccsbBroad304_14560 pLX_304 0% 75.8% 75.8% V5 0_1ins108 n/a
10 TRCN0000479431 ATTAGCCGATGATTAAAGGATATG pLX_317 73.4% 75.8% 75.8% V5 0_1ins108 n/a
11 ccsbBroadEn_05927 pDONR223 100% 62.4% 75.8% None (many diffs) n/a
12 ccsbBroad304_05927 pLX_304 0% 62.4% 75.8% V5 (many diffs) n/a
13 ccsbBroadEn_14558 pDONR223 0% 62.1% 75.8% None (many diffs) n/a
14 ccsbBroad304_14558 pLX_304 0% 62.1% 75.8% V5 (many diffs) n/a
15 TRCN0000491401 GTACCTCCCATCCAAAATTATCTA pLX_317 13.2% 61.9% 75.1% V5 (many diffs) n/a
16 ccsbBroadEn_00207 pDONR223 100% 61.7% 75.8% None (many diffs) n/a
17 ccsbBroad304_00207 pLX_304 0% 61.7% 75.8% V5 (many diffs) n/a
18 TRCN0000479230 GGATCATGATACTATTCGCCTACT pLX_317 100% 61.7% 75.8% V5 (many diffs) n/a
19 ccsbBroadEn_14559 pDONR223 0% 61.7% 75.8% None (many diffs) n/a
20 ccsbBroad304_14559 pLX_304 0% 61.7% 75.8% V5 (many diffs) n/a
21 TRCN0000481399 TTCTACTGACGAGTCGGCTAAACG pLX_317 100% 61.7% 75.8% V5 (many diffs) n/a
22 ccsbBroadEn_05928 pDONR223 100% 61.5% 75.1% None (many diffs) n/a
23 ccsbBroad304_05928 pLX_304 0% 61.5% 75.1% V5 (many diffs) n/a
24 TRCN0000465291 TGGTCACCCCCCTTCGGCACCTGG pLX_317 70.6% 61.5% 75.1% V5 (many diffs) n/a
25 ccsbBroadEn_13822 pDONR223 100% 60.2% 2.8% None (many diffs) n/a
26 ccsbBroad304_13822 pLX_304 0% 60.2% 2.8% V5 (not translated due to prior stop codon) (many diffs) n/a
27 TRCN0000472282 AACCGACGTTCACAAGTCAGGGCC pLX_317 87.8% 60.2% 2.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV