Transcript: Human NM_001329973.1

Homo sapiens zinc finger protein 208 (ZNF208), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ZNF208 (7757)
Length:
1044
CDS:
150..575

Additional Resources:

NCBI RefSeq record:
NM_001329973.1
NBCI Gene record:
ZNF208 (7757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013040 CCCAGTTATATGTTCTCATTT pLKO.1 371 CDS 100% 13.200 6.600 Y ZNF208 n/a
2 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 245 CDS 100% 4.950 2.475 Y ZNF493 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15729 pDONR223 0% 51.6% 41.6% None (many diffs) n/a
2 ccsbBroad304_15729 pLX_304 0% 51.6% 41.6% V5 (many diffs) n/a
3 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 51.6% 41.6% V5 (many diffs) n/a
4 ccsbBroadEn_13746 pDONR223 100% 49.1% 44.6% None (many diffs) n/a
5 ccsbBroad304_13746 pLX_304 0% 49.1% 44.6% V5 (many diffs) n/a
6 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 49.1% 44.6% V5 (many diffs) n/a
7 ccsbBroadEn_11384 pDONR223 100% 48.5% 43.3% None (many diffs) n/a
8 ccsbBroad304_11384 pLX_304 0% 48.5% 43.3% V5 (many diffs) n/a
9 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 48.5% 43.3% V5 (many diffs) n/a
10 ccsbBroadEn_11549 pDONR223 100% 30.4% 21.5% None (many diffs) n/a
11 ccsbBroad304_11549 pLX_304 94.6% 30.4% 21.5% V5 (many diffs) n/a
12 TRCN0000468281 AACATTAGGAAAGAACCCCCACCC pLX_317 100% 30.4% 21.5% V5 (many diffs) n/a
Download CSV