Transcript: Human NM_001344.4

Homo sapiens defender against cell death 1 (DAD1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
DAD1 (1603)
Length:
684
CDS:
68..409

Additional Resources:

NCBI RefSeq record:
NM_001344.4
NBCI Gene record:
DAD1 (1603)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001344.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310240 GACGCGTACCTGCTGTATATA pLKO_005 149 CDS 100% 15.000 21.000 N DAD1 n/a
2 TRCN0000083040 GCGGTTCTTAGAAGAGTACTT pLKO.1 97 CDS 100% 4.950 6.930 N DAD1 n/a
3 TRCN0000093701 CCTAGCGGTTTGCCTGAGAAT pLKO.1 271 CDS 100% 4.950 3.960 N Dad1 n/a
4 TRCN0000083042 CTAGCGGTTTGCCTGAGAATA pLKO.1 272 CDS 100% 13.200 9.240 N DAD1 n/a
5 TRCN0000083039 CCCACAGAACAAAGCGGATTT pLKO.1 301 CDS 100% 10.800 7.560 N DAD1 n/a
6 TRCN0000290404 CCCACAGAACAAAGCGGATTT pLKO_005 301 CDS 100% 10.800 7.560 N DAD1 n/a
7 TRCN0000083038 CTCTTTGAATTTCCTGGATAA pLKO.1 459 3UTR 100% 10.800 7.560 N DAD1 n/a
8 TRCN0000290465 CTCTTTGAATTTCCTGGATAA pLKO_005 459 3UTR 100% 10.800 7.560 N DAD1 n/a
9 TRCN0000083041 GCACCTTGTTGTCATGAACTT pLKO.1 379 CDS 100% 4.950 3.465 N DAD1 n/a
10 TRCN0000290464 GCACCTTGTTGTCATGAACTT pLKO_005 379 CDS 100% 4.950 3.465 N DAD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001344.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06080 pDONR223 100% 99.7% 99.1% None 59C>T n/a
2 ccsbBroad304_06080 pLX_304 0% 99.7% 99.1% V5 59C>T n/a
3 TRCN0000480073 GGACCCGAACGTCACTGCTATACC pLX_317 100% 99.7% 99.1% V5 59C>T n/a
Download CSV