Transcript: Human NM_001346747.2

Homo sapiens RAB11 family interacting protein 4 (RAB11FIP4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
RAB11FIP4 (84440)
Length:
8027
CDS:
136..1548

Additional Resources:

NCBI RefSeq record:
NM_001346747.2
NBCI Gene record:
RAB11FIP4 (84440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420142 ACGACTTGAATGGGCAGATTT pLKO_005 1316 CDS 100% 13.200 18.480 N RAB11FIP4 n/a
2 TRCN0000426670 CTCAAGCAGGAGAATTATAAG pLKO_005 1279 CDS 100% 13.200 18.480 N RAB11FIP4 n/a
3 TRCN0000056504 GCACGTGTACAACAGCGAATT pLKO.1 420 CDS 100% 0.000 0.000 N RAB11FIP4 n/a
4 TRCN0000413922 TCTAGTACGATGGGCTCTTTC pLKO_005 1922 3UTR 100% 10.800 7.560 N RAB11FIP4 n/a
5 TRCN0000056503 CGACAATGACATCACAGAGAA pLKO.1 642 CDS 100% 4.950 3.465 N RAB11FIP4 n/a
6 TRCN0000056507 CTCAAGTCTCAAACAGAGAAA pLKO.1 961 CDS 100% 4.950 3.465 N RAB11FIP4 n/a
7 TRCN0000056505 GAGGCAGTACATGGACAAGAT pLKO.1 1476 CDS 100% 4.950 3.465 N RAB11FIP4 n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6048 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6048 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6046 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6046 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6046 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 4973 3UTR 100% 4.950 2.475 Y DENND6A n/a
14 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 5011 3UTR 100% 4.050 2.025 Y ERN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09188 pDONR223 100% 72.9% 72.3% None (many diffs) n/a
2 ccsbBroad304_09188 pLX_304 0% 72.9% 72.3% V5 (many diffs) n/a
3 TRCN0000491312 CGAGTGTGCGGCGCCGCGCAGCCA pLX_317 11% 72.9% 72.3% V5 (many diffs) n/a
Download CSV