Transcript: Mouse NM_001346806.1

Mus musculus SH3-domain GRB2-like endophilin B2 (Sh3glb2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Sh3glb2 (227700)
Length:
1837
CDS:
112..1326

Additional Resources:

NCBI RefSeq record:
NM_001346806.1
NBCI Gene record:
Sh3glb2 (227700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323061 GGAGACTAGACCTCGTAATTA pLKO_005 702 CDS 100% 15.000 21.000 N SH3GLB2 n/a
2 TRCN0000093572 AGGAGACTAGACCTCGTAATT pLKO.1 701 CDS 100% 13.200 18.480 N Sh3glb2 n/a
3 TRCN0000166184 CGTCAAGTCTCAGACAACCTA pLKO.1 891 CDS 100% 3.000 2.400 N SH3GLB2 n/a
4 TRCN0000093569 GCCCGTCATTCAGCTATTAAA pLKO.1 1414 3UTR 100% 15.000 10.500 N Sh3glb2 n/a
5 TRCN0000324388 GCCCGTCATTCAGCTATTAAA pLKO_005 1414 3UTR 100% 15.000 10.500 N Sh3glb2 n/a
6 TRCN0000093570 CGAGTGGAGGAGTTCCTATAT pLKO.1 322 CDS 100% 13.200 9.240 N Sh3glb2 n/a
7 TRCN0000324389 CGAGTGGAGGAGTTCCTATAT pLKO_005 322 CDS 100% 13.200 9.240 N Sh3glb2 n/a
8 TRCN0000166673 CCTGACTTTCAGGAGACTAGA pLKO.1 691 CDS 100% 4.950 3.465 N SH3GLB2 n/a
9 TRCN0000093573 GATCAGCAGTACTCATGTGAA pLKO.1 846 CDS 100% 4.950 3.465 N Sh3glb2 n/a
10 TRCN0000324460 GATCAGCAGTACTCATGTGAA pLKO_005 846 CDS 100% 4.950 3.465 N Sh3glb2 n/a
11 TRCN0000093571 TCAGGAGACTAGACCTCGTAA pLKO.1 699 CDS 100% 4.950 3.465 N Sh3glb2 n/a
12 TRCN0000324461 TCAGGAGACTAGACCTCGTAA pLKO_005 699 CDS 100% 4.950 3.465 N Sh3glb2 n/a
13 TRCN0000380406 AGTCTCAGACAACCTACTATG pLKO_005 896 CDS 100% 10.800 6.480 N Sh3glb2 n/a
14 TRCN0000162304 CAAGTCTCAGACAACCTACTA pLKO.1 894 CDS 100% 4.950 2.970 N SH3GLB2 n/a
15 TRCN0000165782 CACCAAGAACTGGACAGAGAA pLKO.1 255 CDS 100% 4.950 3.465 N SH3GLB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03753 pDONR223 100% 88.5% 94.5% None (many diffs) n/a
2 ccsbBroad304_03753 pLX_304 0% 88.5% 94.5% V5 (many diffs) n/a
3 TRCN0000469605 TACACTTGGTCCCTTGTGCAGTAC pLX_317 28.5% 88.5% 94.5% V5 (many diffs) n/a
Download CSV