Transcript: Mouse NM_001347125.1

Mus musculus vesicle-associated membrane protein 4 (Vamp4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Vamp4 (53330)
Length:
5039
CDS:
106..531

Additional Resources:

NCBI RefSeq record:
NM_001347125.1
NBCI Gene record:
Vamp4 (53330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347125.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348352 GGACCATCTGGACCAAGATTT pLKO_005 223 CDS 100% 13.200 18.480 N Vamp4 n/a
2 TRCN0000381837 GGACCATCTGGACCAAGATTT pLKO_005 223 CDS 100% 13.200 18.480 N VAMP4 n/a
3 TRCN0000348275 TCAGAAAGCTTATCGGATAAT pLKO_005 367 CDS 100% 13.200 18.480 N Vamp4 n/a
4 TRCN0000382053 TCAGAAAGCTTATCGGATAAT pLKO_005 367 CDS 100% 13.200 18.480 N VAMP4 n/a
5 TRCN0000380967 TTAGTTGATGCCCAGTGAAAT pLKO_005 3112 3UTR 100% 13.200 18.480 N Vamp4 n/a
6 TRCN0000374583 AGTTTATAAGCTGGGAAATTT pLKO_005 3308 3UTR 100% 15.000 10.500 N Vamp4 n/a
7 TRCN0000098991 CCAAGATTTGGACCTAGAAAT pLKO.1 235 CDS 100% 13.200 9.240 N Vamp4 n/a
8 TRCN0000098990 GCCATCTTAGTCCATACAAAT pLKO.1 3898 3UTR 100% 13.200 9.240 N Vamp4 n/a
9 TRCN0000382078 ATGCAAGAGAATATTACAAAG pLKO_005 304 CDS 100% 10.800 7.560 N Vamp4 n/a
10 TRCN0000381653 CAAACAGCTTCGAAGGCAAAT pLKO_005 411 CDS 100% 10.800 7.560 N Vamp4 n/a
11 TRCN0000129433 GACCATCTGGACCAAGATTTG pLKO.1 224 CDS 100% 10.800 7.560 N VAMP4 n/a
12 TRCN0000348350 GGGTTCCTCCTCCATCATAAC pLKO_005 3217 3UTR 100% 10.800 7.560 N Vamp4 n/a
13 TRCN0000098994 CAGGACAAATCAGAAAGCTTA pLKO.1 358 CDS 100% 4.950 3.465 N Vamp4 n/a
14 TRCN0000098993 CCACCGCTTTCAGCAACAGAT pLKO.1 389 CDS 100% 4.950 3.465 N Vamp4 n/a
15 TRCN0000130415 GACCAAGATTTGGACCTAGAA pLKO.1 233 CDS 100% 4.950 3.465 N VAMP4 n/a
16 TRCN0000098992 GCTGGATGAACTACAGGACAA pLKO.1 345 CDS 100% 4.050 2.835 N Vamp4 n/a
17 TRCN0000334779 GCTGGATGAACTACAGGACAA pLKO_005 345 CDS 100% 4.050 2.835 N Vamp4 n/a
18 TRCN0000129282 CTGGACCAAGATTTGGACCTA pLKO.1 230 CDS 100% 2.640 1.848 N VAMP4 n/a
19 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2023 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347125.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01987 pDONR223 100% 93.8% 97.1% None (many diffs) n/a
2 ccsbBroad304_01987 pLX_304 0% 93.8% 97.1% V5 (many diffs) n/a
3 TRCN0000481388 CTGACATGCAGATAACTTGGTTAC pLX_317 100% 93.8% 97.1% V5 (many diffs) n/a
4 ccsbBroadEn_15641 pDONR223 0% 93.3% 96.4% None (many diffs) n/a
5 ccsbBroad304_15641 pLX_304 0% 93.3% 96.4% V5 (many diffs) n/a
6 TRCN0000467223 TCCCTGGAGCACACAACACCTAAC pLX_317 80.6% 93.3% 96.4% V5 (many diffs) n/a
Download CSV