Transcript: Mouse NM_001347379.1

Mus musculus ets variant 1 (Etv1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Etv1 (14009)
Length:
4268
CDS:
428..1807

Additional Resources:

NCBI RefSeq record:
NM_001347379.1
NBCI Gene record:
Etv1 (14009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415222 GCGGGAGTAATCTAGACATTC pLKO_005 2007 3UTR 100% 10.800 6.480 N Etv1 n/a
2 TRCN0000239510 AGTCGTTCTCTCCGCTATTAT pLKO_005 1541 CDS 100% 15.000 7.500 Y Gm5454 n/a
3 TRCN0000419514 GTCGTTCTCTCCGCTATTATT pLKO_005 1542 CDS 100% 15.000 7.500 Y Etv1 n/a
4 TRCN0000239506 GATCCTTCGGAATCTTCATTT pLKO_005 2616 3UTR 100% 13.200 6.600 Y Gm5454 n/a
5 TRCN0000428375 ACGAAGGATACGTGTACTAAC pLKO_005 1788 CDS 100% 10.800 5.400 Y Etv1 n/a
6 TRCN0000239509 TCTATGGCCTTTCCGGATAAC pLKO_005 1640 CDS 100% 10.800 5.400 Y Gm5454 n/a
7 TRCN0000075477 CCCTTCAAATTCTCATTTCAT pLKO.1 1414 CDS 100% 5.625 2.813 Y Etv1 n/a
8 TRCN0000075476 GCGATGAACTATGACAAACTT pLKO.1 1520 CDS 100% 5.625 2.813 Y Etv1 n/a
9 TRCN0000075475 CCGGCGATGAACTATGACAAA pLKO.1 1517 CDS 100% 4.950 2.475 Y Etv1 n/a
10 TRCN0000075473 CGGAATCTTCATTTAAGTGTT pLKO.1 2623 3UTR 100% 4.950 2.475 Y Etv1 n/a
11 TRCN0000239507 ACGAAGGATACGTGTACTAAG pLKO_005 1788 CDS 100% 10.800 5.400 Y Gm5454 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00520 pDONR223 100% 90% 93.9% None (many diffs) n/a
2 ccsbBroad304_00520 pLX_304 27.6% 90% 93.9% V5 (many diffs) n/a
3 TRCN0000469733 CACAGGTTACAGTGGTGTTCAGCC pLX_317 10.3% 90% 93.9% V5 (many diffs) n/a
Download CSV