Transcript: Human NM_001348279.2

Homo sapiens zinc finger protein 141 (ZNF141), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
ZNF141 (7700)
Length:
3420
CDS:
171..614

Additional Resources:

NCBI RefSeq record:
NM_001348279.2
NBCI Gene record:
ZNF141 (7700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 187 CDS 100% 5.625 2.813 Y ZNF765 n/a
2 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 595 CDS 100% 4.950 2.475 Y LOC387873 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1020 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1020 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13469 pDONR223 100% 57.3% 50% None (many diffs) n/a
2 ccsbBroad304_13469 pLX_304 0% 57.3% 50% V5 (many diffs) n/a
3 TRCN0000469082 CACTTTTCAGCTCGAAATTAAATC pLX_317 100% 57.3% 50% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 42.3% 25.4% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 42.3% 25.4% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 42.3% 25.4% V5 (many diffs) n/a
7 ccsbBroadEn_11616 pDONR223 100% 38.3% 18.2% None (many diffs) n/a
8 ccsbBroad304_11616 pLX_304 0% 38.3% 18.2% V5 (many diffs) n/a
9 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 38.3% 18.2% V5 (many diffs) n/a
10 ccsbBroadEn_14883 pDONR223 94% 26.3% 15.6% None (many diffs) n/a
11 ccsbBroad304_14883 pLX_304 0% 26.3% 15.6% V5 (many diffs) n/a
12 TRCN0000478123 AGAAGATGTATCCTCCGGGTTGTT pLX_317 11.6% 26.3% 15.6% V5 (many diffs) n/a
13 ccsbBroadEn_10261 pDONR223 100% 9.7% 6% None (many diffs) n/a
14 ccsbBroad304_10261 pLX_304 0% 9.7% 6% V5 (many diffs) n/a
15 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 9.7% 6% V5 (many diffs) n/a
Download CSV