Transcript: Human NM_001353459.2

Homo sapiens zinc finger protein 665 (ZNF665), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF665 (79788)
Length:
4154
CDS:
89..2125

Additional Resources:

NCBI RefSeq record:
NM_001353459.2
NBCI Gene record:
ZNF665 (79788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236243 CTCACGGCTAACAAGTCATAA pLKO_005 658 CDS 100% 13.200 18.480 N ZNF665 n/a
2 TRCN0000107463 CAGTATTCACACTTAGCAAAT pLKO.1 1325 CDS 100% 10.800 8.640 N ZNF665 n/a
3 TRCN0000236245 AGTTGAGAAGTCTCCTAATAA pLKO_005 586 CDS 100% 15.000 10.500 N ZNF665 n/a
4 TRCN0000236247 CATGCATGCTGAGACTATTAC pLKO_005 2689 3UTR 100% 13.200 9.240 N ZNF665 n/a
5 TRCN0000107460 GCCAATTACTTTCAGCTTATA pLKO.1 2873 3UTR 100% 13.200 9.240 N ZNF665 n/a
6 TRCN0000107461 GTCTCCTAATAATCGAGGAAA pLKO.1 595 CDS 100% 4.950 3.465 N ZNF665 n/a
7 TRCN0000107464 CAGACAATACATACTGGACAA pLKO.1 1685 CDS 100% 4.050 2.835 N ZNF665 n/a
8 TRCN0000107462 CCTTCAAACCTTGCAGGTCAT pLKO.1 824 CDS 100% 4.050 2.835 N ZNF665 n/a
9 TRCN0000236246 GTTCATTCAAGCCTAACTATA pLKO_005 1661 CDS 100% 13.200 7.920 N ZNF665 n/a
10 TRCN0000236244 ATGCATTCAAACTTAACTAAG pLKO_005 1241 CDS 100% 10.800 6.480 N ZNF665 n/a
11 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 784 CDS 100% 10.800 5.400 Y Rex2 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2160 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2161 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000021816 CTGGAGAGAAACCTTACAGAT pLKO.1 1362 CDS 100% 4.950 2.475 Y ZNF253 n/a
15 TRCN0000155654 CTGGAGAGAAACCTTACAGAT pLKO.1 1362 CDS 100% 4.950 2.475 Y ZNF320 n/a
16 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 1131 CDS 100% 4.950 2.475 Y ZNF813 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14339 pDONR223 100% 7.4% .4% None (many diffs) n/a
2 ccsbBroad304_14339 pLX_304 0% 7.4% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 7.4% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV