Transcript: Human NM_001354367.1

Homo sapiens fibroblast growth factor receptor 1 (FGFR1), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
FGFR1 (2260)
Length:
4702
CDS:
943..3435

Additional Resources:

NCBI RefSeq record:
NM_001354367.1
NBCI Gene record:
FGFR1 (2260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121311 GAATGAGTACGGCAGCATCAA pLKO.1 1635 CDS 100% 4.950 6.930 N FGFR1 n/a
2 TRCN0000121183 TGGAGTTAATACCACCGACAA pLKO.1 1878 CDS 100% 4.050 5.670 N FGFR1 n/a
3 TRCN0000121103 CCGGCCTCTATGCTTGCGTAA pLKO.1 1229 CDS 100% 1.350 1.890 N FGFR1 n/a
4 TRCN0000312516 GATGGCACCCGAGGCATTATT pLKO_005 2934 CDS 100% 15.000 12.000 N FGFR1 n/a
5 TRCN0000381505 GAGTTAATACCACCGACAAAG pLKO_005 1880 CDS 100% 10.800 8.640 N FGFR1 n/a
6 TRCN0000121104 CGGGAAGCATAAGAATATCAT pLKO.1 2550 CDS 100% 5.625 4.500 N FGFR1 n/a
7 TRCN0000121185 CCACAGAATTGGAGGCTACAA pLKO.1 1536 CDS 100% 4.950 3.960 N FGFR1 n/a
8 TRCN0000312572 CCACAGAATTGGAGGCTACAA pLKO_005 1536 CDS 100% 4.950 3.960 N FGFR1 n/a
9 TRCN0000195394 CCACTCCTCAGTCGCTATATT pLKO.1 4148 3UTR 100% 15.000 10.500 N FGFR1 n/a
10 TRCN0000429862 TGAAGACTGCTGGAGTTAATA pLKO_005 1868 CDS 100% 15.000 10.500 N Fgfr1 n/a
11 TRCN0000199475 GCTGCAGTGTTGGCGACTATT pLKO.1 4285 3UTR 100% 13.200 9.240 N FGFR1 n/a
12 TRCN0000312574 TGCCACCTGGAGCATCATAAT pLKO_005 1566 CDS 100% 13.200 9.240 N FGFR1 n/a
13 TRCN0000427411 CCACCTACTTCTCCGTCAATG pLKO_005 1274 CDS 100% 10.800 7.560 N Fgfr1 n/a
14 TRCN0000121105 GCCAAGACAGTGAAGTTCAAA pLKO.1 1447 CDS 100% 5.625 3.938 N FGFR1 n/a
15 TRCN0000000421 AGGGCTGGAATACTGCTACAA pLKO.1 2673 CDS 100% 4.950 3.465 N FGFR1 n/a
16 TRCN0000195683 CGCAGATCTTGGCTTCTTACA pLKO.1 3965 3UTR 100% 4.950 3.465 N FGFR1 n/a
17 TRCN0000121106 GAGATGGAGGTGCTTCACTTA pLKO.1 1900 CDS 100% 4.950 3.465 N FGFR1 n/a
18 TRCN0000121186 TCTTGAAGACTGCTGGAGTTA pLKO.1 1865 CDS 100% 4.950 3.465 N FGFR1 n/a
19 TRCN0000121309 CTTGTATGTCATCGTGGAGTA pLKO.1 2604 CDS 100% 4.050 2.835 N FGFR1 n/a
20 TRCN0000199308 CGCAGGATGGTCCCTTGTATG pLKO.1 2591 CDS 100% 3.600 2.520 N FGFR1 n/a
21 TRCN0000000420 CGTCAATGTTTCAGATGCTCT pLKO.1 1287 CDS 100% 2.640 1.848 N FGFR1 n/a
22 TRCN0000000418 CGAGGCATTATTTGACCGGAT pLKO.1 2943 CDS 100% 2.160 1.512 N FGFR1 n/a
23 TRCN0000199924 GCCCAGTAACTGCACCAACGA pLKO.1 3099 CDS 100% 0.880 0.616 N FGFR1 n/a
24 TRCN0000121310 CAAGATGAAGAGTGGTACCAA pLKO.1 2127 CDS 100% 0.000 0.000 N FGFR1 n/a
25 TRCN0000000419 CAGAGGAGAAAGAAACAGATA pLKO.1 1349 CDS 100% 4.950 2.970 N FGFR1 n/a
26 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3494 3UTR 100% 4.950 2.475 Y ERAP2 n/a
27 TRCN0000023295 CCTGGAGCATCATAATGGATT pLKO.1 1571 CDS 100% 4.950 2.970 N Fgfr1 n/a
28 TRCN0000321966 CCTGGAGCATCATAATGGATT pLKO_005 1571 CDS 100% 4.950 2.970 N Fgfr1 n/a
29 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3495 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14638 pDONR223 0% 94.6% 91% None (many diffs) n/a
2 ccsbBroad304_14638 pLX_304 0% 94.6% 91% V5 (many diffs) n/a
3 TRCN0000488713 AAGAGGCTTCCCATAGTAATAAAT pLX_317 14.1% 94.1% 90.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000487850 TTTCTCTGAGTTGCTCGTATCGCG pLX_317 20.3% 45.7% 42.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV