Transcript: Human NM_001354983.2

Homo sapiens discoidin domain receptor tyrosine kinase 2 (DDR2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DDR2 (4921)
Length:
10503
CDS:
777..3344

Additional Resources:

NCBI RefSeq record:
NM_001354983.2
NBCI Gene record:
DDR2 (4921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147364 CCGTGACAAACCGAGCACTG pXPR_003 GGG 989 39% 9 0.7388 DDR2 DDR2 77972
2 BRDN0001487155 GTAATTGATCTTGTACATGG pXPR_003 GGG 349 14% 5 0.7142 DDR2 DDR2 77975
3 BRDN0001147906 AAGTTGATGACAGCAACACT pXPR_003 CGG 1191 46% 11 0.7076 DDR2 DDR2 77974
4 BRDN0001147484 GGGCTAGGCCAATTGACCGA pXPR_003 TGG 698 27% 8 0.2754 DDR2 DDR2 77973
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195175 CCCATGTACAAGATCAATTAC pLKO.1 1122 CDS 100% 13.200 18.480 N DDR2 n/a
2 TRCN0000195105 CGAAACTGTTTAGTGGGTAAG pLKO.1 2916 CDS 100% 6.000 8.400 N DDR2 n/a
3 TRCN0000121263 GATGGCTTGGTGTCTTACAAT pLKO.1 1341 CDS 100% 5.625 7.875 N DDR2 n/a
4 TRCN0000199773 GCTCAGGTCCTCCCTACAAGA pLKO.1 3374 3UTR 100% 1.650 2.310 N DDR2 n/a
5 TRCN0000121173 CAATGGCTACATTGAGATCAT pLKO.1 1571 CDS 100% 0.495 0.396 N DDR2 n/a
6 TRCN0000196465 GTACCTTTCCTCTCTTAATTT pLKO.1 2873 CDS 100% 0.000 0.000 N DDR2 n/a
7 TRCN0000121121 CCCTGGAGGTTCCATCATTTA pLKO.1 1388 CDS 100% 13.200 9.240 N DDR2 n/a
8 TRCN0000001421 CTCAGGTTAATCCAGCTATAT pLKO.1 844 CDS 100% 13.200 9.240 N DDR2 n/a
9 TRCN0000121175 GCTGTCAGATGAACAGGTTAT pLKO.1 3149 CDS 100% 10.800 7.560 N DDR2 n/a
10 TRCN0000121174 GATTCTAGCATGTTCAACAAT pLKO.1 2124 CDS 100% 5.625 3.938 N DDR2 n/a
11 TRCN0000001418 GCCAGATTTGTCCGGTTCATT pLKO.1 1257 CDS 100% 5.625 3.938 N DDR2 n/a
12 TRCN0000121264 CCACTCCATGAATGTGTGTAT pLKO.1 1289 CDS 100% 4.950 3.465 N DDR2 n/a
13 TRCN0000121176 CCATCAAGTGTCAATACCATT pLKO.1 1810 CDS 100% 4.950 3.465 N DDR2 n/a
14 TRCN0000001419 GCCAAGTGATTCTAGCATGTT pLKO.1 2117 CDS 100% 4.950 3.465 N DDR2 n/a
15 TRCN0000121266 GTTTGCTAAAGGTGTGAAGAT pLKO.1 1649 CDS 100% 4.950 3.465 N DDR2 n/a
16 TRCN0000121120 TCCATCTATTAGCTGTGTGTA pLKO.1 2689 CDS 100% 4.950 3.465 N DDR2 n/a
17 TRCN0000001420 GCTGACATAGTGAACCTCCAA pLKO.1 2346 CDS 100% 2.640 1.848 N DDR2 n/a
18 TRCN0000121262 CCATGTTCCTACGGCTCAGGT pLKO.1 3361 3UTR 100% 0.880 0.616 N DDR2 n/a
19 TRCN0000121117 CCCATGCCTATGCCACTCCAT pLKO.1 3406 3UTR 100% 0.880 0.616 N DDR2 n/a
20 TRCN0000121172 CCTACCACTCACCCATGCCTA pLKO.1 3395 3UTR 100% 0.880 0.616 N DDR2 n/a
21 TRCN0000121119 CCCAAACATCATCCATCTATT pLKO.1 2678 CDS 100% 13.200 7.920 N DDR2 n/a
22 TRCN0000121118 CCGTCCCTCATTCCAAGAAAT pLKO.1 3290 CDS 100% 13.200 7.920 N DDR2 n/a
23 TRCN0000001417 GCCAACAAGAATGCCAGGAAT pLKO.1 2616 CDS 100% 4.950 2.970 N DDR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14724 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14724 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480958 ATCCTACGCACTACGAATTCCACA pLX_317 16.9% 99.9% 99.8% V5 2245C>T;2565delG n/a
4 TRCN0000489117 AATACTATCCATGATCAAATACAC pLX_317 13.2% 99.9% 100% V5 (not translated due to prior stop codon) 1260C>G n/a
5 TRCN0000489473 ACGTCGGTTGGTGTTTGACACTCA pLX_317 13.4% 99.9% 99.8% V5 1260C>G;2565_2566insG n/a
6 TRCN0000491495 GGCGCTTACCCTTACAACAATAGT pLX_317 24.9% 49.1% 49.1% V5 (not translated due to prior stop codon) 1_1305del n/a
Download CSV