Transcript: Human NM_001364008.1

Homo sapiens notch 2 N-terminal like B (NOTCH2NLB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
NOTCH2NLB (100996763)
Length:
8326
CDS:
301..1050

Additional Resources:

NCBI RefSeq record:
NM_001364008.1
NBCI Gene record:
NOTCH2NLB (100996763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303565 AGACTATGCGTGGCACAATAC pLKO_005 1365 3UTR 100% 10.800 5.400 Y NOTCH2NLA n/a
2 TRCN0000056425 CCAACCAGTTCTCCTGCAAAT pLKO.1 710 CDS 100% 10.800 5.400 Y NOTCH2NLA n/a
3 TRCN0000315755 CCAACCAGTTCTCCTGCAAAT pLKO_005 710 CDS 100% 10.800 5.400 Y NOTCH2NLA n/a
4 TRCN0000056423 CAGGGAAGTCTGGAATGGAAA pLKO.1 1011 CDS 100% 4.950 2.475 Y NOTCH2NLA n/a
5 TRCN0000303501 GAACAGAGCTCTGGGAAAGAG pLKO_005 989 CDS 100% 4.950 2.475 Y NOTCH2NLA n/a
6 TRCN0000056424 GCCTTCCAGAAACAGTGAGAA pLKO.1 965 CDS 100% 4.950 2.475 Y NOTCH2NLA n/a
7 TRCN0000315754 GCCTTCCAGAAACAGTGAGAA pLKO_005 965 CDS 100% 4.950 2.475 Y NOTCH2NLA n/a
8 TRCN0000303503 CACGATGAGAATTAGACACTG pLKO_005 1036 CDS 100% 4.050 2.025 Y NOTCH2NLA n/a
9 TRCN0000056427 GCTGCCAGAATGGTGGGACTT pLKO.1 437 CDS 100% 1.350 0.675 Y NOTCH2NLA n/a
10 TRCN0000056426 GATGTCAATGAGTGTGACATT pLKO.1 766 CDS 100% 0.495 0.248 Y NOTCH2NLA n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 5980 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05590 pDONR223 100% 94.5% 94.3% None 1_39del;228A>G;512T>C n/a
2 ccsbBroad304_05590 pLX_304 0% 94.5% 94.3% V5 1_39del;228A>G;512T>C n/a
3 TRCN0000475093 GCAACGCCCATGGACAGAAATTTG pLX_317 63.7% 94.5% 94.3% V5 1_39del;228A>G;512T>C n/a
4 ccsbBroadEn_16165 pDONR223 0% 94.5% 94.7% None 1_39del;228A>G;324A>G n/a
5 ccsbBroad304_16165 pLX_304 0% 94.5% 94.7% V5 1_39del;228A>G;324A>G n/a
6 TRCN0000468587 AGTAGAGTCACTATGTGCAGACGG pLX_317 46.4% 94.5% 94.7% V5 1_39del;228A>G;324A>G n/a
7 TRCN0000491825 ACTTACATCTCACATCAAAAATCC pLX_317 46.2% 94.5% 94.7% V5 (not translated due to prior stop codon) 1_39del;228A>G;324A>G n/a
8 ccsbBroadEn_11001 pDONR223 100% 19.2% 18.2% None (many diffs) n/a
9 ccsbBroad304_11001 pLX_304 17.4% 19.2% 18.2% V5 (many diffs) n/a
10 TRCN0000476980 ACTACTCGCACCGTTAGCAGCTCT pLX_317 11.4% 19.2% 18.2% V5 (many diffs) n/a
11 TRCN0000488666 GTTCTATAACAGGGCACCACCCTG pLX_317 4.5% 9.6% 9.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV