Transcript: Human NM_001364568.1

Homo sapiens general transcription factor IIH subunit 2 (GTF2H2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
GTF2H2 (2966)
Length:
1848
CDS:
280..1359

Additional Resources:

NCBI RefSeq record:
NM_001364568.1
NBCI Gene record:
GTF2H2 (2966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364568.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425360 CATAGCTATGCAGACTCTAAA pLKO_005 729 CDS 100% 13.200 7.920 N GTF2H2 n/a
2 TRCN0000415156 GAGCTACCTGTTGAGTGTAAA pLKO_005 1177 CDS 100% 13.200 7.920 N GTF2H2 n/a
3 TRCN0000337240 ACTTGCGATCCATCTAATATT pLKO_005 805 CDS 100% 15.000 7.500 Y GTF2H2C_2 n/a
4 TRCN0000255677 TTGCGATCCATCTAATATTTA pLKO_005 807 CDS 100% 15.000 7.500 Y GTF2H2B n/a
5 TRCN0000255678 CCAAGATTTAAAGCCTAATAG pLKO_005 498 CDS 100% 13.200 6.600 Y GTF2H2B n/a
6 TRCN0000350794 GCTTACATTAGGAGGCTATTT pLKO_005 1128 CDS 100% 13.200 6.600 Y GTF2H2C_2 n/a
7 TRCN0000263115 GGAATGATGCGCCACCTTTAT pLKO_005 445 CDS 100% 13.200 6.600 Y GTF2H2C n/a
8 TRCN0000263116 GGATCACTTAAAGCTACAATA pLKO_005 361 CDS 100% 13.200 6.600 Y GTF2H2C n/a
9 TRCN0000374264 GGATCACTTAAAGCTACAATA pLKO_005 361 CDS 100% 13.200 6.600 Y Gtf2h2 n/a
10 TRCN0000337272 GGCACGGTCTTACCATCATTT pLKO_005 1233 CDS 100% 13.200 6.600 Y GTF2H2C_2 n/a
11 TRCN0000020964 GTCACAGAAATACCTGAAATT pLKO.1 1684 3UTR 100% 13.200 6.600 Y GTF2H2 n/a
12 TRCN0000255675 TACAAGTCGAGAAGTACTAAT pLKO_005 765 CDS 100% 13.200 6.600 Y GTF2H2B n/a
13 TRCN0000255676 TCTTTAGAAGAAGCTTCATTT pLKO_005 1584 3UTR 100% 13.200 6.600 Y GTF2H2B n/a
14 TRCN0000263118 TGTCACAGAAATACCTGAAAT pLKO_005 1683 3UTR 100% 13.200 6.600 Y GTF2H2C n/a
15 TRCN0000431651 ACAAGTCGAGAAGTACTAATC pLKO_005 766 CDS 100% 10.800 5.400 Y GTF2H2 n/a
16 TRCN0000337239 CACTGTACTTGCTCGTGAAAC pLKO_005 903 CDS 100% 10.800 5.400 Y GTF2H2C_2 n/a
17 TRCN0000020967 CCTATTAGTCAGATTGGAATA pLKO.1 577 CDS 100% 10.800 5.400 Y GTF2H2 n/a
18 TRCN0000263117 GACCAAGATTTAAAGCCTAAT pLKO_005 496 CDS 100% 10.800 5.400 Y GTF2H2C n/a
19 TRCN0000263119 GATCTAATCAAGACCCTAAAG pLKO_005 829 CDS 100% 10.800 5.400 Y GTF2H2C n/a
20 TRCN0000337299 GCATGTAGTATACATTGTATG pLKO_005 1526 3UTR 100% 10.800 5.400 Y GTF2H2C_2 n/a
21 TRCN0000423846 TGATTCCAGCATGTAGTATAC pLKO_005 1518 3UTR 100% 10.800 5.400 Y GTF2H2 n/a
22 TRCN0000020966 CCTGGCTGTATTCATAAGATT pLKO.1 1479 3UTR 100% 5.625 2.813 Y GTF2H2 n/a
23 TRCN0000020965 CGCCACCTTTATGTGGTAGTA pLKO.1 454 CDS 100% 4.950 2.475 Y GTF2H2 n/a
24 TRCN0000020968 GCTCACTTATTCGTATGGGAT pLKO.1 1019 CDS 100% 2.640 1.320 Y GTF2H2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364568.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05740 pDONR223 100% 89.5% 85.4% None (many diffs) n/a
2 ccsbBroad304_05740 pLX_304 0% 89.5% 85.4% V5 (many diffs) n/a
3 TRCN0000466876 CCCACCACTCTGTACATCGGTATC pLX_317 32.2% 89.5% 85.4% V5 (many diffs) n/a
4 ccsbBroadEn_15438 pDONR223 0% 45.6% 44% None (many diffs) n/a
5 ccsbBroad304_15438 pLX_304 0% 45.6% 44% V5 (many diffs) n/a
6 TRCN0000474784 ACGTATCGAGCTAAGCGACCTGAC pLX_317 100% 45.6% 44% V5 (many diffs) n/a
Download CSV