Transcript: Human NM_001365782.1

Homo sapiens tropomyosin 1 (TPM1), transcript variant 19, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
TPM1 (7168)
Length:
2866
CDS:
88..834

Additional Resources:

NCBI RefSeq record:
NM_001365782.1
NBCI Gene record:
TPM1 (7168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438285 CTGAAGATGCCGACCGCAAAT pLKO_005 443 CDS 100% 10.800 15.120 N TPM1 n/a
2 TRCN0000062148 CAACGATATGACTTCCATGTA pLKO.1 813 CDS 100% 4.950 6.930 N TPM1 n/a
3 TRCN0000062149 CGGAGAGGTCAGTAACTAAAT pLKO.1 704 CDS 100% 13.200 9.240 N TPM1 n/a
4 TRCN0000062151 GCCCGTAAGCTGGTCATCATT pLKO.1 475 CDS 100% 5.625 3.938 N TPM1 n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1391 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 1446 3UTR 100% 4.050 2.025 Y LOC441087 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1392 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07091 pDONR223 100% 94% 92.7% None (many diffs) n/a
2 ccsbBroad304_07091 pLX_304 0% 94% 92.7% V5 (many diffs) n/a
3 TRCN0000481549 GATCAAGGGTCTCTCCCCTACTAG pLX_317 63.1% 94% 92.7% V5 (many diffs) n/a
4 ccsbBroadEn_07090 pDONR223 100% 77.5% 70.3% None (many diffs) n/a
5 ccsbBroad304_07090 pLX_304 0% 77.5% 70.3% V5 (many diffs) n/a
6 TRCN0000492218 CAAACTCGTCTCTACCATCGTAAC pLX_317 61.1% 77.5% 70.3% V5 (many diffs) n/a
Download CSV