Transcript: Human NM_001365985.2

Homo sapiens nuclear factor I X (NFIX), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
NFIX (4784)
Length:
5714
CDS:
219..1541

Additional Resources:

NCBI RefSeq record:
NM_001365985.2
NBCI Gene record:
NFIX (4784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234769 TAGGCTAAGAAACGCAGTATA pLKO_005 5346 3UTR 100% 13.200 18.480 N NFIX n/a
2 TRCN0000014774 CCTGTTGATGACGTGTTCTAT pLKO.1 1080 CDS 100% 5.625 7.875 N NFIX n/a
3 TRCN0000225945 GGAATCCGGACAATCAGATAG pLKO_005 773 CDS 100% 10.800 8.640 N Nfix n/a
4 TRCN0000234767 GGAATCCGGACAATCAGATAG pLKO_005 773 CDS 100% 10.800 8.640 N NFIX n/a
5 TRCN0000234766 ATCTTTATCTGGCTTACTTTG pLKO_005 742 CDS 100% 10.800 7.560 N NFIX n/a
6 TRCN0000225946 CCCAACGGGCACTTAAGTTTC pLKO_005 831 CDS 100% 10.800 7.560 N Nfix n/a
7 TRCN0000234768 CCCAACGGGCACTTAAGTTTC pLKO_005 831 CDS 100% 10.800 7.560 N NFIX n/a
8 TRCN0000014777 CACATCACATTGGAGTCACAA pLKO.1 709 CDS 100% 4.950 3.465 N NFIX n/a
9 TRCN0000075349 CCGGACAATCAGATAGTTCAA pLKO.1 778 CDS 100% 4.950 3.465 N Nfix n/a
10 TRCN0000014775 ACTGGATCTTTATCTGGCTTA pLKO.1 737 CDS 100% 4.050 2.835 N NFIX n/a
11 TRCN0000014773 GCAGTCTCAGTCCTGGTTCCT pLKO.1 1552 3UTR 100% 0.880 0.616 N NFIX n/a
12 TRCN0000014776 CCGGCTTCTCTAAAGAAGTCA pLKO.1 1173 CDS 100% 0.300 0.210 N NFIX n/a
13 TRCN0000257244 TGGACCTGGTCATGGTGATTT pLKO_005 601 CDS 100% 13.200 7.920 N Nfix n/a
14 TRCN0000234765 ACATTGGAGTCACAATCAAAG pLKO_005 715 CDS 100% 10.800 6.480 N NFIX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14713 pDONR223 62.1% 99.6% 99.5% None 779T>C;783G>A;1297_1299delTCGinsGGT n/a
2 ccsbBroad304_14713 pLX_304 0% 99.6% 99.5% V5 779T>C;783G>A;1297_1299delTCGinsGGT n/a
3 TRCN0000478179 ATTAACTCACTCCAACAAGGAAAG pLX_317 37.2% 59.9% 59.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV