Transcript: Human NM_001366481.2

Homo sapiens ribosomal protein L7 like 1 (RPL7L1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
RPL7L1 (285855)
Length:
4499
CDS:
296..1063

Additional Resources:

NCBI RefSeq record:
NM_001366481.2
NBCI Gene record:
RPL7L1 (285855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234707 AGGATTGACGGCGTGAGTTTA pLKO_005 605 CDS 100% 13.200 18.480 N RPL7L1 n/a
2 TRCN0000117687 CCTAAGAGTTATAGGCTTAAA pLKO.1 1263 3UTR 100% 13.200 18.480 N RPL7L1 n/a
3 TRCN0000234709 TGCGTATAGTGGAACCTTATG pLKO_005 714 CDS 100% 10.800 15.120 N RPL7L1 n/a
4 TRCN0000117690 CCTTTGTTGTACGCATCGAAA pLKO.1 585 CDS 100% 4.950 6.930 N RPL7L1 n/a
5 TRCN0000117689 GCTGCGTATAGTGGAACCTTA pLKO.1 712 CDS 100% 4.950 6.930 N RPL7L1 n/a
6 TRCN0000117688 GCCTTGGAATTGCCAGATAAA pLKO.1 554 CDS 100% 13.200 9.240 N RPL7L1 n/a
7 TRCN0000234706 TGCCTTGGAATTGCCAGATAA pLKO_005 553 CDS 100% 13.200 9.240 N RPL7L1 n/a
8 TRCN0000234708 CATTGCAAGACTTCGCCTAAA pLKO_005 640 CDS 100% 10.800 7.560 N RPL7L1 n/a
9 TRCN0000234710 CCTTGAGATTGGGAGGAATAG pLKO_005 1168 3UTR 100% 10.800 7.560 N RPL7L1 n/a
10 TRCN0000117691 GCAAAGAAGGAGCAGAAGAAA pLKO.1 431 CDS 100% 5.625 3.375 N RPL7L1 n/a
11 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1408 3UTR 100% 4.950 2.475 Y ORAI2 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1332 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 2810 3UTR 100% 4.950 2.475 Y CCNJL n/a
14 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 3816 3UTR 100% 4.050 2.025 Y P3H4 n/a
15 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 3816 3UTR 100% 4.050 2.025 Y ORAI2 n/a
16 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 3816 3UTR 100% 4.050 2.025 Y P3H4 n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1333 3UTR 100% 13.200 6.600 Y LIAS n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3014 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1405 3UTR 100% 4.950 2.475 Y LOC339059 n/a
20 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2086 3UTR 100% 4.950 2.475 Y DCAF11 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3014 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05409 pDONR223 100% 96.4% 96.4% None 1_27del n/a
2 ccsbBroad304_05409 pLX_304 0% 96.4% 96.4% V5 1_27del n/a
3 TRCN0000474109 TTTCTCAGGTAGGCTTATACGCCG pLX_317 52.2% 96.4% 96.4% V5 1_27del n/a
Download CSV