Transcript: Human NM_001366975.1

Homo sapiens pregnancy up-regulated nonubiquitous CaM kinase (PNCK), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
PNCK (139728)
Length:
2104
CDS:
668..1699

Additional Resources:

NCBI RefSeq record:
NM_001366975.1
NBCI Gene record:
PNCK (139728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148324 GGAGCAGAAACCCTACGGGA pXPR_003 AGG 568 55% 8 1.1005 PNCK PNCK 77329
2 BRDN0001145068 ATCCTCCAGAGCGACGATGT pXPR_003 TGG 217 21% 5 0.1681 PNCK PNCK 77328
3 BRDN0001145537 GCGTCTACGAGATCCGCGAG pXPR_003 AGG 54 5% 3 0.1563 PNCK PNCK 77327
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021571 CATCAGCAGCGTCTACGAGAT pLKO.1 697 CDS 100% 4.050 5.670 N PNCK n/a
2 TRCN0000021572 GATCGCAGTGCTCCGTAGGAT pLKO.1 850 CDS 100% 1.000 1.400 N PNCK n/a
3 TRCN0000315432 CCTTCGACAGGGACATCTTAG pLKO_005 1491 CDS 100% 10.800 7.560 N PNCK n/a
4 TRCN0000381077 ACATCTCAGAATCAGCCAAAG pLKO_005 1380 CDS 100% 6.000 4.200 N PNCK n/a
5 TRCN0000315431 TTCCTTCCCTTGGATGCTTTC pLKO_005 1742 3UTR 100% 6.000 4.200 N PNCK n/a
6 TRCN0000381892 GCCCTTTGAGGACTCGAAGAT pLKO_005 1105 CDS 100% 4.950 3.465 N PNCK n/a
7 TRCN0000199140 CGGAAGAACTTTGCTCGGACA pLKO.1 1532 CDS 100% 2.160 1.512 N PNCK n/a
8 TRCN0000021573 CCTCGTGGCCCTCAAGTGCAT pLKO.1 784 CDS 100% 0.000 0.000 N PNCK n/a
9 TRCN0000350552 CCTCGTGGCCCTCAAGTGCAT pLKO_005 784 CDS 100% 0.000 0.000 N PNCK n/a
10 TRCN0000021569 GCTATGAGTTTGACTCTCCTT pLKO.1 1350 CDS 100% 2.640 1.584 N PNCK n/a
11 TRCN0000315430 GCTATGAGTTTGACTCTCCTT pLKO_005 1350 CDS 100% 2.640 1.584 N PNCK n/a
12 TRCN0000199949 GCGAGCTGTTTGACCGCATCA pLKO.1 954 CDS 100% 1.350 0.810 N PNCK n/a
13 TRCN0000021570 CGAGAGCCCTTCCCACCTCTA pLKO.1 907 CDS 100% 0.000 0.000 N PNCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491589 CTAAACCTTTCCAAATGAGTCACC pLX_317 86% 24.8% 24.7% V5 68_69ins87;278_1029del n/a
2 ccsbBroadEn_13199 pDONR223 100% 24.7% 24.7% None 68_69ins87;277_1029del n/a
3 ccsbBroad304_13199 pLX_304 0% 24.7% 24.7% V5 68_69ins87;277_1029del n/a
4 TRCN0000465807 GCCCCCCATACACAAGTGACTCCA pLX_317 55.3% 24.7% 24.7% V5 68_69ins87;277_1029del n/a
5 ccsbBroadEn_15252 pDONR223 0% 24.7% 24.7% None 68_69ins87;277_1029del n/a
6 ccsbBroad304_15252 pLX_304 0% 24.7% 24.7% V5 68_69ins87;277_1029del n/a
7 TRCN0000471652 TCGAAGAAAGCGAATCCCTTGCAG pLX_317 72.3% 24.7% 24.7% V5 68_69ins87;277_1029del n/a
8 TRCN0000488639 GACCAGCTCATGTGGATGCGCCAA pLX_317 69.1% 24.7% 24.7% V5 (not translated due to prior stop codon) 68_69ins87;277_1029del n/a
Download CSV