Transcript: Human NM_001369538.1

Homo sapiens neurotrophic receptor tyrosine kinase 2 (NTRK2), transcript variant n, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NTRK2 (4915)
Length:
8095
CDS:
401..2014

Additional Resources:

NCBI RefSeq record:
NM_001369538.1
NBCI Gene record:
NTRK2 (4915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273160 CCTTAAGGATAACTAACATTT pLKO_005 1146 CDS 100% 13.200 18.480 N NTRK2 n/a
2 TRCN0000197207 GCGCTTCAGTGGTTCTATAAC pLKO.1 1340 CDS 100% 13.200 18.480 N NTRK2 n/a
3 TRCN0000284928 ATCGTGGCATTTCCGAGATTG pLKO_005 554 CDS 100% 10.800 15.120 N NTRK2 n/a
4 TRCN0000195114 CCTAATATGTATTGGGATGTT pLKO.1 1076 CDS 100% 4.950 6.930 N NTRK2 n/a
5 TRCN0000002243 CCAACTATCACATTTCTCGAA pLKO.1 1259 CDS 100% 2.640 2.112 N NTRK2 n/a
6 TRCN0000273089 TCCTGGTGGGCAATCCATTTA pLKO_005 831 CDS 100% 13.200 9.240 N NTRK2 n/a
7 TRCN0000196299 GACTGAGAAATCTGACAATTG pLKO.1 675 CDS 100% 10.800 7.560 N NTRK2 n/a
8 TRCN0000002242 CCACTCCATCACATCTCCAAT pLKO.1 1838 CDS 100% 4.950 3.465 N NTRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01113 pDONR223 100% 87.5% 85.8% None (many diffs) n/a
2 ccsbBroad304_01113 pLX_304 0% 87.5% 85.8% V5 (many diffs) n/a
3 ccsbBroadEn_14721 pDONR223 0% 64.5% 64.2% None (many diffs) n/a
4 ccsbBroad304_14721 pLX_304 0% 64.5% 64.2% V5 (many diffs) n/a
5 TRCN0000480309 ACAATAAGTGTCCCAGTTAAGTTT pLX_317 14.3% 64.5% 64.2% V5 (many diffs) n/a
6 TRCN0000488063 CTCACTGTCGAGCAACCATACTGA pLX_317 13% 64.5% 64.2% V5 (many diffs) n/a
7 TRCN0000488161 TATCAGACTTTGGGGGGGCAAAAC pLX_317 12.7% 64.5% 64.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV