Transcript: Human NM_001369551.1

Homo sapiens neurotrophic receptor tyrosine kinase 2 (NTRK2), transcript variant z, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NTRK2 (4915)
Length:
6453
CDS:
365..1330

Additional Resources:

NCBI RefSeq record:
NM_001369551.1
NBCI Gene record:
NTRK2 (4915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273160 CCTTAAGGATAACTAACATTT pLKO_005 642 CDS 100% 13.200 18.480 N NTRK2 n/a
2 TRCN0000197207 GCGCTTCAGTGGTTCTATAAC pLKO.1 836 CDS 100% 13.200 18.480 N NTRK2 n/a
3 TRCN0000195114 CCTAATATGTATTGGGATGTT pLKO.1 572 CDS 100% 4.950 6.930 N NTRK2 n/a
4 TRCN0000002243 CCAACTATCACATTTCTCGAA pLKO.1 755 CDS 100% 2.640 2.112 N NTRK2 n/a
5 TRCN0000273089 TCCTGGTGGGCAATCCATTTA pLKO_005 327 5UTR 100% 13.200 9.240 N NTRK2 n/a
6 TRCN0000196299 GACTGAGAAATCTGACAATTG pLKO.1 171 5UTR 100% 10.800 7.560 N NTRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01113 pDONR223 100% 67.2% 67.2% None 0_1ins468 n/a
2 ccsbBroad304_01113 pLX_304 0% 67.2% 67.2% V5 0_1ins468 n/a
3 ccsbBroadEn_14721 pDONR223 0% 38.3% 37.5% None (many diffs) n/a
4 ccsbBroad304_14721 pLX_304 0% 38.3% 37.5% V5 (many diffs) n/a
5 TRCN0000480309 ACAATAAGTGTCCCAGTTAAGTTT pLX_317 14.3% 38.3% 37.5% V5 (many diffs) n/a
6 TRCN0000488063 CTCACTGTCGAGCAACCATACTGA pLX_317 13% 38.3% 37.5% V5 (many diffs) n/a
7 TRCN0000488161 TATCAGACTTTGGGGGGGCAAAAC pLX_317 12.7% 38.3% 37.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV