Transcript: Human NM_001369768.1

Homo sapiens zinc finger protein 28 (ZNF28), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ZNF28 (7576)
Length:
397
CDS:
122..346

Additional Resources:

NCBI RefSeq record:
NM_001369768.1
NBCI Gene record:
ZNF28 (7576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 232 CDS 100% 2.640 1.320 Y ZNF765 n/a
2 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 224 CDS 100% 13.200 6.600 Y Zfp874a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14339 pDONR223 100% 71.1% 4% None (many diffs) n/a
2 ccsbBroad304_14339 pLX_304 0% 71.1% 4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 71.1% 4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_08581 pDONR223 100% 12.6% 11% None (many diffs) n/a
5 ccsbBroad304_08581 pLX_304 0% 12.6% 11% V5 (many diffs) n/a
6 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 12.6% 11% V5 (many diffs) n/a
Download CSV