Transcript: Human NM_001371499.1

Homo sapiens LIM zinc finger domain containing 1 (LIMS1), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-08-01
Taxon:
Homo sapiens (human)
Gene:
LIMS1 (3987)
Length:
957
CDS:
42..395

Additional Resources:

NCBI RefSeq record:
NM_001371499.1
NBCI Gene record:
LIMS1 (3987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071465 GAGAAGATCGTGAACAGTAAT pLKO.1 288 CDS 100% 13.200 7.920 N Lims1 n/a
2 TRCN0000301713 GAGAAGATCGTGAACAGTAAT pLKO_005 288 CDS 100% 13.200 7.920 N Lims1 n/a
3 TRCN0000435782 CCCTCACACTGGACTATAAAT pLKO_005 558 3UTR 100% 15.000 7.500 Y LIMS3 n/a
4 TRCN0000429410 ATGGTTAAGCTACCTTCATTA pLKO_005 395 CDS 100% 13.200 6.600 Y LIMS3 n/a
5 TRCN0000427718 GTCCTGAGGAAGATTACTATT pLKO_005 675 3UTR 100% 13.200 6.600 Y LIMS3 n/a
6 TRCN0000148822 CAGTGACGTGAAAGTCTACAA pLKO.1 176 CDS 100% 4.950 2.475 Y LIMS3 n/a
7 TRCN0000148598 CTACAAGGAGTTCTGTGACTT pLKO.1 191 CDS 100% 4.950 2.475 Y LIMS3 n/a
8 TRCN0000148093 GCATCTGGAGAATAAGACATT pLKO.1 744 3UTR 100% 4.950 2.475 Y LIMS3 n/a
9 TRCN0000149869 CGTGAAAGTCTACAAGGAGTT pLKO.1 182 CDS 100% 4.050 2.025 Y LIMS3 n/a
10 TRCN0000149061 GACTCTTCTATGAGGAACGAA pLKO.1 370 CDS 100% 3.000 1.500 Y LIMS3 n/a
11 TRCN0000149649 GAAGGACTCTTCTATGAGGAA pLKO.1 366 CDS 100% 2.640 1.320 Y LIMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04624 pDONR223 100% 99.4% 99.1% None 251A>C;351A>G n/a
2 ccsbBroad304_04624 pLX_304 0% 99.4% 99.1% V5 251A>C;351A>G n/a
3 TRCN0000469496 CCTGCACGGGACAGCCCGTCTAAT pLX_317 100% 99.4% 99.1% V5 251A>C;351A>G n/a
4 ccsbBroadEn_06524 pDONR223 100% 14% 13.4% None (many diffs) n/a
5 ccsbBroad304_06524 pLX_304 0% 14% 13.4% V5 (many diffs) n/a
6 TRCN0000468941 TAGATCCTATTATCCCACTCTTGT pLX_317 39.8% 14% 13.4% V5 (many diffs) n/a
Download CSV