Transcript: Human NM_001721.7

Homo sapiens BMX non-receptor tyrosine kinase (BMX), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
BMX (660)
Length:
2511
CDS:
112..2139

Additional Resources:

NCBI RefSeq record:
NM_001721.7
NBCI Gene record:
BMX (660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001721.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006360 CGTGCATACAAATGCTGAGAA pLKO.1 1161 CDS 100% 4.950 6.930 N BMX n/a
2 TRCN0000196445 GTGTTCTCTGTATTGTCTATT pLKO.1 2247 3UTR 100% 13.200 10.560 N BMX n/a
3 TRCN0000006361 GCCCTATGACTTGTATGACAA pLKO.1 1944 CDS 100% 4.950 3.960 N BMX n/a
4 TRCN0000006359 GAGTGCTGATAAGAATGAATA pLKO.1 2152 3UTR 100% 13.200 9.240 N BMX n/a
5 TRCN0000196600 GATCACAATCTGAACAGTTAC pLKO.1 1019 CDS 100% 10.800 7.560 N BMX n/a
6 TRCN0000194950 CCCATATACATAGTGACTGAA pLKO.1 1561 CDS 100% 4.950 3.465 N BMX n/a
7 TRCN0000006362 GCAATATGACAGCAACTCAAA pLKO.1 753 CDS 100% 4.950 3.465 N BMX n/a
8 TRCN0000006363 CCATTGAACCACTTCGGGAAA pLKO.1 2105 CDS 100% 4.050 2.835 N BMX n/a
9 TRCN0000199362 CGCCACCCTGTGTCAACAAAG pLKO.1 1276 CDS 100% 3.600 2.520 N BMX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001721.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14552 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14552 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480919 GTGGTCTCAGGGCTGCCCGAGAGT pLX_317 20.6% 100% 100% V5 n/a
4 TRCN0000488575 CACTTCTTCCTCCTATACAACCTT pLX_317 18.6% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000491668 CAGCGTATAACCGGCGGCCTCGTA pLX_317 14.7% 99.9% 99.8% V5 2025_2026insG n/a
6 ccsbBroadEn_05900 pDONR223 100% 99.9% 100% None 9A>G n/a
7 ccsbBroad304_05900 pLX_304 0% 99.9% 100% V5 9A>G n/a
8 TRCN0000476849 GGCCCGTGTTTACACACAAGAATT pLX_317 18.5% 99.9% 100% V5 9A>G n/a
9 TRCN0000488720 TTTCTTAGATCGCCTGACTGGATT pLX_317 18.2% 99.9% 99.8% V5 (not translated due to prior stop codon) 1542A>G;1692C>A n/a
Download CSV