Transcript: Human NM_001896.4

Homo sapiens casein kinase 2 alpha 2 (CSNK2A2), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CSNK2A2 (1459)
Length:
1887
CDS:
371..1423

Additional Resources:

NCBI RefSeq record:
NM_001896.4
NBCI Gene record:
CSNK2A2 (1459)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144724 TGTGCATGATTCCCTTGCTG pXPR_003 TGG 449 43% 6 0.7745 CSNK2A2 CSNK2A2 75586
2 BRDN0001148502 AGTTTACCTGATAGTCCACG pXPR_003 AGG 614 58% 7 0.2258 CSNK2A2 CSNK2A2 75588
3 BRDN0001147190 TAGCAAGCATGATCTTTCGA pXPR_003 AGG 684 65% 8 -0.4275 CSNK2A2 CSNK2A2 75587
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001896.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382114 TCAAACGTCTTAACGCGTATA pLKO_005 1488 3UTR 100% 10.800 15.120 N CSNK2A2 n/a
2 TRCN0000000614 CTGGGACAACATTCACGGAAA pLKO.1 1190 CDS 100% 4.050 5.670 N CSNK2A2 n/a
3 TRCN0000318620 CTGGGACAACATTCACGGAAA pLKO_005 1190 CDS 100% 4.050 5.670 N CSNK2A2 n/a
4 TRCN0000025666 GTATGATTATAGCTTGGACAT pLKO.1 997 CDS 100% 4.050 3.240 N Csnk2a2 n/a
5 TRCN0000000611 GCGGCAGTTACATATTATTAT pLKO.1 1826 3UTR 100% 15.000 10.500 N CSNK2A2 n/a
6 TRCN0000025667 CCAGCTTTGGTATTTGAATAT pLKO.1 698 CDS 100% 13.200 9.240 N Csnk2a2 n/a
7 TRCN0000196663 GATCCTGACAGACTTTGATAT pLKO.1 751 CDS 100% 13.200 9.240 N CSNK2A2 n/a
8 TRCN0000380736 ATCAAACCTCACTTCCGAATG pLKO_005 1598 3UTR 100% 6.000 4.200 N CSNK2A2 n/a
9 TRCN0000379457 ATGCAGAATGTTGTTGGTTAC pLKO_005 1691 3UTR 100% 6.000 4.200 N CSNK2A2 n/a
10 TRCN0000194896 CCTCACAATGTCATGATAGAT pLKO.1 848 CDS 100% 5.625 3.938 N CSNK2A2 n/a
11 TRCN0000318690 CCTCACAATGTCATGATAGAT pLKO_005 848 CDS 100% 5.625 3.938 N CSNK2A2 n/a
12 TRCN0000000613 CGTGGTGGAACAAATATCATT pLKO.1 638 CDS 100% 5.625 3.938 N CSNK2A2 n/a
13 TRCN0000318689 CGTGGTGGAACAAATATCATT pLKO_005 638 CDS 100% 5.625 3.938 N CSNK2A2 n/a
14 TRCN0000196745 GCCATTAATATCACCAACAAT pLKO.1 539 CDS 100% 5.625 3.938 N CSNK2A2 n/a
15 TRCN0000000615 AGACCTAGATCCACACTTCAA pLKO.1 1162 CDS 100% 4.950 3.465 N CSNK2A2 n/a
16 TRCN0000000612 CCTCGTGGACTATCAGATGTA pLKO.1 979 CDS 100% 4.950 3.465 N CSNK2A2 n/a
17 TRCN0000318619 CCTCGTGGACTATCAGATGTA pLKO_005 979 CDS 100% 4.950 3.465 N CSNK2A2 n/a
18 TRCN0000197008 GCAGAATGTTGTTGGTTACTG pLKO.1 1693 3UTR 100% 4.950 3.465 N CSNK2A2 n/a
19 TRCN0000025668 CAGGACAACTATGACCAGCTT pLKO.1 1079 CDS 100% 2.640 1.848 N Csnk2a2 n/a
20 TRCN0000321792 CAGGACAACTATGACCAGCTT pLKO_005 1079 CDS 100% 2.640 1.848 N Csnk2a2 n/a
21 TRCN0000025664 GTGAAGTATTTGAGGCCATTA pLKO.1 525 CDS 100% 10.800 6.480 N Csnk2a2 n/a
22 TRCN0000321853 GTGAAGTATTTGAGGCCATTA pLKO_005 525 CDS 100% 10.800 6.480 N Csnk2a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001896.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00382 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00382 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481622 AGACTGACAGTCCTTCTTCCCCTG pLX_317 47.1% 100% 100% V5 n/a
4 TRCN0000489293 CACACGAACCTGTACAGAGAAATG pLX_317 35% 99.9% 99.7% V5 1050_1051insG n/a
5 TRCN0000492298 ACCTTTATGCCGATCAATACAAAT pLX_317 41.1% 99.7% 99.7% V5 (not translated due to prior stop codon) 1050_1051insTTG n/a
Download CSV