Transcript: Human NM_001914.4

Homo sapiens cytochrome b5 type A (CYB5A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CYB5A (1528)
Length:
3255
CDS:
89..385

Additional Resources:

NCBI RefSeq record:
NM_001914.4
NBCI Gene record:
CYB5A (1528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064566 ACTCTACAGATGCCAGGGAAA pLKO.1 291 CDS 100% 4.050 3.240 N CYB5A n/a
2 TRCN0000288973 ACTCTACAGATGCCAGGGAAA pLKO_005 291 CDS 100% 4.050 3.240 N CYB5A n/a
3 TRCN0000064565 GCACCACAAGGTGTACGATTT pLKO.1 178 CDS 100% 10.800 7.560 N CYB5A n/a
4 TRCN0000288908 GCACCACAAGGTGTACGATTT pLKO_005 178 CDS 100% 10.800 7.560 N CYB5A n/a
5 TRCN0000064564 CCATCCAGATGACAGACCAAA pLKO.1 340 CDS 100% 4.950 3.465 N CYB5A n/a
6 TRCN0000288974 CCATCCAGATGACAGACCAAA pLKO_005 340 CDS 100% 4.950 3.465 N CYB5A n/a
7 TRCN0000064567 CCTAGAGGAGATTCAGAAGCA pLKO.1 127 CDS 100% 2.640 1.848 N CYB5A n/a
8 TRCN0000288975 CCTAGAGGAGATTCAGAAGCA pLKO_005 127 CDS 100% 2.640 1.848 N CYB5A n/a
9 TRCN0000064563 GCTACTGAGAACTTTGAGGAT pLKO.1 263 CDS 100% 2.640 1.848 N CYB5A n/a
10 TRCN0000288907 GCTACTGAGAACTTTGAGGAT pLKO_005 263 CDS 100% 2.640 1.848 N CYB5A n/a
11 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1196 3UTR 100% 4.950 2.475 Y ORAI2 n/a
12 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1157 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1157 3UTR 100% 4.050 2.025 Y ORAI2 n/a
14 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1157 3UTR 100% 4.050 2.025 Y P3H4 n/a
15 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1186 3UTR 100% 13.200 6.600 Y IQCC n/a
16 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1283 3UTR 100% 10.800 5.400 Y SMIM11A n/a
17 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1193 3UTR 100% 4.950 2.475 Y LOC339059 n/a
18 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 3006 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00401 pDONR223 100% 72.8% 72.3% None 292C>A;294_295ins108 n/a
2 ccsbBroad304_00401 pLX_304 0% 72.8% 72.3% V5 292C>A;294_295ins108 n/a
3 TRCN0000475059 GCCACATACAAACGTAGACCTTTA pLX_317 77.7% 72.8% 72.3% V5 292C>A;294_295ins108 n/a
4 TRCN0000488397 AATTGGCTATTAGTACGTGATGGT pLX_317 68.6% 72.8% 72.3% V5 (not translated due to prior stop codon) 292C>A;294_295ins108 n/a
Download CSV