Transcript: Human NM_002985.3

Homo sapiens C-C motif chemokine ligand 5 (CCL5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CCL5 (6352)
Length:
1217
CDS:
56..331

Additional Resources:

NCBI RefSeq record:
NM_002985.3
NBCI Gene record:
CCL5 (6352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002985.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058006 GAAATGGGTTCGGGAGTACAT pLKO.1 289 CDS 100% 4.950 6.930 N CCL5 n/a
2 TRCN0000058007 CGTGCCCACATCAAGGAGTAT pLKO.1 185 CDS 100% 4.950 3.960 N CCL5 n/a
3 TRCN0000371691 TGAACCTGAACTTACACAAAT pLKO_005 345 3UTR 100% 13.200 9.240 N CCL5 n/a
4 TRCN0000371627 CCTGCTGCTTTGCCTACATTG pLKO_005 150 CDS 100% 10.800 7.560 N CCL5 n/a
5 TRCN0000377748 CTACCACACAGCAGCAGTTAC pLKO_005 451 3UTR 100% 10.800 7.560 N CCL5 n/a
6 TRCN0000058004 CCACATCAAGGAGTATTTCTA pLKO.1 190 CDS 100% 5.625 3.938 N CCL5 n/a
7 TRCN0000058005 GTATTTCTACACCAGTGGCAA pLKO.1 202 CDS 100% 2.640 1.848 N CCL5 n/a
8 TRCN0000058003 CGTCTTTGTCACCCGAAAGAA pLKO.1 241 CDS 100% 0.563 0.394 N CCL5 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 505 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 544 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 544 3UTR 100% 4.050 2.025 Y ORAI2 n/a
12 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 544 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 573 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 506 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002985.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01498 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01498 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470120 TGTCAGCACTGACAAGGCTACTTA pLX_317 100% 100% 100% V5 n/a
Download CSV