Transcript: Human NM_003188.4

Homo sapiens mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant A, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MAP3K7 (6885)
Length:
4851
CDS:
190..1929

Additional Resources:

NCBI RefSeq record:
NM_003188.4
NBCI Gene record:
MAP3K7 (6885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148226 CACACATGACCAATAACAAG pXPR_003 GGG 567 33% 6 0.129 MAP3K7 MAP3K7 75694
2 BRDN0001145981 CCCAGCTTTCCGAATCATGT pXPR_003 GGG 718 41% 7 0.0694 MAP3K7 MAP3K7 75692
3 BRDN0001148020 ACCCAAAGCGCTAATTCACA pXPR_003 GGG 460 26% 5 -0.2290 MAP3K7 MAP3K7 75693
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003188.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001555 CCCGTGTGAACCATCCTAATA pLKO.1 434 CDS 100% 13.200 18.480 N MAP3K7 n/a
2 TRCN0000001557 GACACACATGACCAATAACAA pLKO.1 738 CDS 100% 5.625 7.875 N MAP3K7 n/a
3 TRCN0000195533 CGGAACCTTTAGGGATAGTTC pLKO.1 2431 3UTR 100% 4.950 6.930 N MAP3K7 n/a
4 TRCN0000022560 CGCCCTTCAATGGAGGAAATT pLKO.1 1009 CDS 100% 13.200 9.240 N Map3k7 n/a
5 TRCN0000322345 CGCCCTTCAATGGAGGAAATT pLKO_005 1009 CDS 100% 13.200 9.240 N Map3k7 n/a
6 TRCN0000195493 CATCCCAATGGCTTATCTTAC pLKO.1 1593 CDS 100% 10.800 7.560 N MAP3K7 n/a
7 TRCN0000196674 GCTTCTACAAATACGAGTAAC pLKO.1 1156 CDS 100% 10.800 7.560 N MAP3K7 n/a
8 TRCN0000001554 GCAGTGATTCTTGGATTGTTT pLKO.1 2763 3UTR 100% 5.625 3.938 N MAP3K7 n/a
9 TRCN0000001558 TCCTGCCACAAATGATACTAT pLKO.1 1203 CDS 100% 5.625 3.938 N MAP3K7 n/a
10 TRCN0000022559 AGGCAAAGCAACAGAGTGAAT pLKO.1 1256 CDS 100% 4.950 3.465 N Map3k7 n/a
11 TRCN0000322277 AGGCAAAGCAACAGAGTGAAT pLKO_005 1256 CDS 100% 4.950 3.465 N Map3k7 n/a
12 TRCN0000001556 CAGTGTGTCTTGTGATGGAAT pLKO.1 485 CDS 100% 4.950 3.465 N MAP3K7 n/a
13 TRCN0000195532 CCATCCAAGACTTGACTGTAA pLKO.1 1424 CDS 100% 4.950 3.465 N MAP3K7 n/a
14 TRCN0000195383 CGGAAACCCTTTGATGAGATT pLKO.1 865 CDS 100% 4.950 3.465 N MAP3K7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003188.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14856 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14856 pLX_304 39% 100% 100% V5 (not translated due to frame shift) n/a
3 TRCN0000473540 CTTAATAACGAGGATTAACAACGT pLX_317 27.1% 100% 100% V5 (not translated due to frame shift) n/a
4 TRCN0000488462 TTCAGTCTCGCGCTAGGCGCCATT pLX_317 18.3% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489475 TTACTCACCAATTCGGAAGAAGGT pLX_317 25.4% 84.8% 82.9% V5 1444_1559del;1590_1737delinsG n/a
6 TRCN0000488961 GTCGGACGCGGTCTCTGATGACCG pLX_317 24.6% 84.8% 82.9% V5 (not translated due to prior stop codon) 1444_1559del;1590_1737del n/a
Download CSV