Transcript: Human NM_003301.6

Homo sapiens thyrotropin releasing hormone receptor (TRHR), mRNA.

Source:
NCBI, updated 2019-09-11
Taxon:
Homo sapiens (human)
Gene:
TRHR (7201)
Length:
3651
CDS:
345..1541

Additional Resources:

NCBI RefSeq record:
NM_003301.6
NBCI Gene record:
TRHR (7201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003301.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358146 GTGCCATCAACCCGGTGATTT pLKO_005 1282 CDS 100% 13.200 18.480 N TRHR n/a
2 TRCN0000358148 CTAGTGGTTGTCAACTCATTT pLKO_005 1197 CDS 100% 0.000 0.000 N TRHR n/a
3 TRCN0000014190 CCTCCAGTATTTGGGAATTAA pLKO.1 653 CDS 100% 15.000 10.500 N TRHR n/a
4 TRCN0000358219 GAATTACTACTCACCTATTTA pLKO_005 899 CDS 100% 15.000 10.500 N TRHR n/a
5 TRCN0000014192 CCATCTTACTTGTACTCATTA pLKO.1 427 CDS 100% 13.200 9.240 N TRHR n/a
6 TRCN0000014188 GCCCAGTTTCTCTGCACATTT pLKO.1 741 CDS 100% 13.200 9.240 N TRHR n/a
7 TRCN0000014189 CCCGGTGATTTACAATCTCAT pLKO.1 1292 CDS 100% 4.950 3.465 N TRHR n/a
8 TRCN0000014191 CCTATTTACCTAATGGACTTT pLKO.1 912 CDS 100% 4.950 3.465 N TRHR n/a
9 TRCN0000027839 GCAGTGGTTGTAATTCTGTTT pLKO.1 1149 CDS 100% 4.950 3.465 N Trhr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003301.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01711 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01711 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475816 CGCACAGCGTTGAAACACGAAACA pLX_317 28.5% 100% 100% V5 n/a
4 TRCN0000489783 CCTAGTAAAGACAGGGTTTATGTG pLX_317 32% 100% 100% V5 n/a
5 TRCN0000488346 AGCCCAGACCAAATCGGACTCCGC pLX_317 26.4% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV