Transcript: Human NM_003338.5

Homo sapiens ubiquitin conjugating enzyme E2 D1 (UBE2D1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
UBE2D1 (7321)
Length:
2623
CDS:
197..640

Additional Resources:

NCBI RefSeq record:
NM_003338.5
NBCI Gene record:
UBE2D1 (7321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003338.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272504 AGTACCAGATATTGCACAAAT pLKO_005 553 CDS 100% 13.200 9.240 N UBE2D1 n/a
2 TRCN0000003381 CTTCTTTCTCACTGTACATTT pLKO.1 343 CDS 100% 13.200 9.240 N UBE2D1 n/a
3 TRCN0000272448 CTTCTTTCTCACTGTACATTT pLKO_005 343 CDS 100% 13.200 9.240 N UBE2D1 n/a
4 TRCN0000272503 TACATGTATGTCAACTCATTA pLKO_005 1094 3UTR 100% 13.200 9.240 N UBE2D1 n/a
5 TRCN0000003383 GCCATTAGTCACCATTAGTTA pLKO.1 1577 3UTR 100% 5.625 3.938 N UBE2D1 n/a
6 TRCN0000003385 ACAACAGACATGCAAGAGAAT pLKO.1 597 CDS 100% 4.950 3.465 N UBE2D1 n/a
7 TRCN0000272505 ACAACAGACATGCAAGAGAAT pLKO_005 597 CDS 100% 4.950 3.465 N UBE2D1 n/a
8 TRCN0000003382 GTTCTCTACTTTGTGATCCTA pLKO.1 516 CDS 100% 3.000 2.100 N UBE2D1 n/a
9 TRCN0000003384 GCGATCCACCTGCTCACTGTT pLKO.1 240 CDS 100% 1.650 0.990 N UBE2D1 n/a
10 TRCN0000284782 GCGATCCACCTGCTCACTGTT pLKO_005 240 CDS 100% 1.650 0.990 N UBE2D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003338.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01735 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01735 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475410 TCCCCCCACGCGCCCCCGCCATCG pLX_317 71.5% 100% 100% V5 n/a
4 ccsbBroadEn_03347 pDONR223 100% 77.5% 91.8% None (many diffs) n/a
5 ccsbBroad304_03347 pLX_304 0% 77.5% 91.8% V5 (many diffs) n/a
6 TRCN0000474875 GGAGATCAGCCTGCAATCCTGTTA pLX_317 72.2% 77.5% 91.8% V5 (many diffs) n/a
Download CSV