Transcript: Human NM_003390.4

Homo sapiens WEE1 G2 checkpoint kinase (WEE1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
WEE1 (7465)
Length:
3588
CDS:
265..2205

Additional Resources:

NCBI RefSeq record:
NM_003390.4
NBCI Gene record:
WEE1 (7465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003390.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274664 CGCTCTGTCAGCCTTACTATA pLKO_005 2179 CDS 100% 13.200 18.480 N Wee1 n/a
2 TRCN0000219074 ATAAACCGATCTTCGTGATAC pLKO_005 3109 3UTR 100% 10.800 15.120 N WEE1 n/a
3 TRCN0000195434 CCGGATTCTTTGTTGCTTCAT pLKO.1 982 CDS 100% 4.950 6.930 N WEE1 n/a
4 TRCN0000274663 CTTTGGTTCACATGGATATAA pLKO_005 1526 CDS 100% 15.000 12.000 N Wee1 n/a
5 TRCN0000226424 TTCTCATGTAGTTCGATATTT pLKO_005 1332 CDS 100% 15.000 12.000 N WEE1 n/a
6 TRCN0000196435 GAAGTTTAGCTGATGCTATAA pLKO.1 1409 CDS 100% 13.200 9.240 N WEE1 n/a
7 TRCN0000196638 GCTGTAAACTTGTAGCATTAA pLKO.1 2773 3UTR 100% 13.200 9.240 N WEE1 n/a
8 TRCN0000226425 GTGGGCAGAAGATGATCATAT pLKO_005 1359 CDS 100% 13.200 9.240 N WEE1 n/a
9 TRCN0000226426 TAATAGAACATCTCGACTTAT pLKO_005 2142 CDS 100% 13.200 9.240 N WEE1 n/a
10 TRCN0000218323 ATGGATGCATTTATGCCATTA pLKO_005 1226 CDS 100% 10.800 7.560 N WEE1 n/a
11 TRCN0000196910 GCAATATGAAGTCCCGGTATA pLKO.1 1130 CDS 100% 10.800 7.560 N WEE1 n/a
12 TRCN0000197067 GCTGTTTGAAATGCCAGAATG pLKO.1 3138 3UTR 100% 10.800 7.560 N WEE1 n/a
13 TRCN0000195415 CCAAGAGTTTGCTCTCCAAAG pLKO.1 836 CDS 100% 6.000 4.200 N WEE1 n/a
14 TRCN0000001701 CTAGAAAGAGTGCAGAACAAT pLKO.1 1982 CDS 100% 5.625 3.938 N WEE1 n/a
15 TRCN0000001703 AGATGAAACAAGACCTGCTAA pLKO.1 1089 CDS 100% 4.950 3.465 N WEE1 n/a
16 TRCN0000001700 CCACCCAGAGTAATAGAACAT pLKO.1 2132 CDS 100% 4.950 3.465 N WEE1 n/a
17 TRCN0000001704 GCCAGTGATTATGAGCTTGAA pLKO.1 1069 CDS 100% 4.950 3.465 N WEE1 n/a
18 TRCN0000001702 GCCTTGTGAATTTGCTGCTAT pLKO.1 2737 3UTR 100% 4.950 3.465 N WEE1 n/a
19 TRCN0000025671 CCACCCAGAGTAATAGAACTT pLKO.1 2132 CDS 100% 4.950 3.465 N Wee1 n/a
20 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 371 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003390.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489041 CACATTGGCTCCGGCCTGGTTTAT pLX_317 20.7% 99.9% 100% V5 (not translated due to prior stop codon) 252C>G n/a
2 TRCN0000488292 TCCAGAGCGACCATCCGGCACCAC pLX_317 14% 99.8% 99.8% V5 252C>G;1938_1939insG n/a
Download CSV