Transcript: Human NM_003618.4

Homo sapiens mitogen-activated protein kinase kinase kinase kinase 3 (MAP4K3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MAP4K3 (8491)
Length:
4335
CDS:
299..2983

Additional Resources:

NCBI RefSeq record:
NM_003618.4
NBCI Gene record:
MAP4K3 (8491)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003618.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382260 ACATTCTATTAACGGATAATG pLKO_005 720 CDS 100% 13.200 18.480 N MAP4K3 n/a
2 TRCN0000335963 TACTACACTGCAAGATCTAAT pLKO_005 1394 CDS 100% 13.200 18.480 N MAP4K3 n/a
3 TRCN0000339119 TACTACACTGCAAGATCTAAT pLKO_005 1394 CDS 100% 13.200 18.480 N Map4k3 n/a
4 TRCN0000194690 CCAGATTGAATCAATAGTGTG pLKO.1 2752 CDS 100% 4.050 5.670 N MAP4K3 n/a
5 TRCN0000335806 ATTCTTGGGTGTGGCTATATT pLKO_005 3377 3UTR 100% 15.000 12.000 N MAP4K3 n/a
6 TRCN0000380444 GAACCACACAAGTGCTTAATT pLKO_005 3166 3UTR 100% 15.000 12.000 N MAP4K3 n/a
7 TRCN0000335805 AGATGTACCAAAGCCTATTAG pLKO_005 1876 CDS 100% 13.200 10.560 N MAP4K3 n/a
8 TRCN0000010534 GCCACCAAAGCCTAAGTCTAT pLKO.1 1603 CDS 100% 4.950 3.960 N MAP4K3 n/a
9 TRCN0000196266 GCAAGTACACTGGTGTTTATA pLKO.1 3543 3UTR 100% 15.000 10.500 N MAP4K3 n/a
10 TRCN0000000665 GTGCCGAAGAAGGGATTTATA pLKO.1 2031 CDS 100% 15.000 10.500 N MAP4K3 n/a
11 TRCN0000379622 ACAATTGCTTGCTATCAATAT pLKO_005 2130 CDS 100% 13.200 9.240 N MAP4K3 n/a
12 TRCN0000195252 CTGTGCATCATCATGGATAAA pLKO.1 1978 CDS 100% 13.200 9.240 N MAP4K3 n/a
13 TRCN0000195007 CACCCAAATATTGTTGCTTAT pLKO.1 506 CDS 100% 10.800 7.560 N MAP4K3 n/a
14 TRCN0000335892 TTCGATTTGAGACGGTCAATC pLKO_005 2553 CDS 100% 10.800 7.560 N MAP4K3 n/a
15 TRCN0000000664 CTGAAGACATACACTAAGAAT pLKO.1 3245 3UTR 100% 5.625 3.938 N MAP4K3 n/a
16 TRCN0000000666 GTCCACTTAGAATGTTTGAAA pLKO.1 2457 CDS 100% 5.625 3.938 N MAP4K3 n/a
17 TRCN0000335889 GTCCACTTAGAATGTTTGAAA pLKO_005 2457 CDS 100% 5.625 3.938 N MAP4K3 n/a
18 TRCN0000195085 CCTGTAAGATTGCTTGTCTTT pLKO.1 3732 3UTR 100% 4.950 3.465 N MAP4K3 n/a
19 TRCN0000000667 CCAGATCATTCCACTTACCAT pLKO.1 1172 CDS 100% 3.000 2.100 N MAP4K3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003618.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489242 TTAAAATAGGCACATTTAAGAAGG pLX_317 14.2% 99.9% 100% V5 (not translated due to prior stop codon) 189T>C n/a
2 TRCN0000491548 AAGAATCCAGGAGATGAAACCATC pLX_317 14.3% 99.9% 99.8% V5 189T>C;2682_2683insG n/a
3 ccsbBroadEn_14897 pDONR223 0% 97.5% 97.6% None 189T>C;1057_1119del;1710A>T n/a
4 ccsbBroad304_14897 pLX_304 0% 97.5% 97.6% V5 189T>C;1057_1119del;1710A>T n/a
5 TRCN0000472930 GTTACTAACTGCTTGTCGTGATCA pLX_317 14.7% 97.5% 97.6% V5 189T>C;1057_1119del;1710A>T n/a
6 TRCN0000466325 CACGGACAGTCGCTCTGTAAGGGC pLX_317 15.9% 97.3% 97.2% V5 (many diffs) n/a
Download CSV