Transcript: Human NM_003716.4

Homo sapiens calcium dependent secretion activator (CADPS), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CADPS (8618)
Length:
5507
CDS:
388..4449

Additional Resources:

NCBI RefSeq record:
NM_003716.4
NBCI Gene record:
CADPS (8618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003716.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159186 GCTATATATGATGCGGATAAT pLKO.1 3544 CDS 100% 13.200 18.480 N CADPS n/a
2 TRCN0000159774 GCCCATGAGATGTTTATCAAT pLKO.1 4549 3UTR 100% 5.625 3.938 N CADPS n/a
3 TRCN0000159393 GCTTCATTCATGTACTATGTA pLKO.1 4752 3UTR 100% 5.625 3.938 N CADPS n/a
4 TRCN0000164609 CGGATGGACTTACAGCTTCAT pLKO.1 4213 CDS 100% 4.950 3.465 N CADPS n/a
5 TRCN0000159415 GCATGGATGAATTTATCTCTT pLKO.1 2378 CDS 100% 4.950 3.465 N CADPS n/a
6 TRCN0000119989 GCCAAGAGCATCAATACCATT pLKO.1 3857 CDS 100% 4.950 3.465 N Cadps n/a
7 TRCN0000163058 CCCAATGTGAACCTACCCAAT pLKO.1 3433 CDS 100% 4.050 2.835 N CADPS n/a
8 TRCN0000163970 CGGTTAATCACTCCTGCCAAA pLKO.1 2998 CDS 100% 4.050 2.835 N CADPS n/a
9 TRCN0000161382 GCAGAGTTACTATGAGGTGTT pLKO.1 927 CDS 100% 4.050 2.835 N CADPS n/a
10 TRCN0000159633 GAAATGATAACACTCTTGGTT pLKO.1 3913 CDS 100% 3.000 2.100 N CADPS n/a
11 TRCN0000119990 CCTGTAACTTTGACCACGCTT pLKO.1 2405 CDS 100% 2.640 1.848 N Cadps n/a
12 TRCN0000164462 CTCTCACTCTTGGAAAGGGTT pLKO.1 2827 CDS 100% 2.640 1.848 N CADPS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003716.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11286 pDONR223 100% 57.3% 57.2% None (many diffs) n/a
2 ccsbBroad304_11286 pLX_304 0% 57.3% 57.2% V5 (many diffs) n/a
3 TRCN0000474770 CTTAATCAGTAGCTTACGTGGCTC pLX_317 10.7% 57.3% 57.2% V5 (many diffs) n/a
4 ccsbBroadEn_11285 pDONR223 100% 15.9% 15.9% None 1_3408del;3476_3477insGTTTGCTAAAATGTG n/a
5 ccsbBroad304_11285 pLX_304 0% 15.9% 15.9% V5 1_3408del;3476_3477insGTTTGCTAAAATGTG n/a
6 TRCN0000472605 AGTAATGACTTTTAGGTGGCCGAA pLX_317 76.9% 15.9% 15.9% V5 1_3408del;3476_3477insGTTTGCTAAAATGTG n/a
Download CSV