Transcript: Human NM_003888.4

Homo sapiens aldehyde dehydrogenase 1 family member A2 (ALDH1A2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ALDH1A2 (8854)
Length:
3386
CDS:
62..1618

Additional Resources:

NCBI RefSeq record:
NM_003888.4
NBCI Gene record:
ALDH1A2 (8854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003888.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220353 GTGGCAATACAGTAGTTATTA pLKO.1 669 CDS 100% 15.000 10.500 N ALDH1A2 n/a
2 TRCN0000233274 GTGGCAATACAGTAGTTATTA pLKO_005 669 CDS 100% 15.000 10.500 N ALDH1A2 n/a
3 TRCN0000220354 GCAACCATGGAATCCCTAAAT pLKO.1 422 CDS 100% 13.200 9.240 N ALDH1A2 n/a
4 TRCN0000233272 TACGCAGGCTGGGCTGATAAA pLKO_005 509 CDS 100% 13.200 9.240 N ALDH1A2 n/a
5 TRCN0000233273 TCCTGTAGATGGAGACTATTT pLKO_005 547 CDS 100% 13.200 9.240 N ALDH1A2 n/a
6 TRCN0000233275 TCTAATATTGGGCAACAATTA pLKO_005 2528 3UTR 100% 13.200 9.240 N ALDH1A2 n/a
7 TRCN0000220352 GCTGGGACTGTTTGGATCAAT pLKO.1 1457 CDS 100% 5.625 3.938 N ALDH1A2 n/a
8 TRCN0000220351 CCAGATTGATAAGAAACAGTA pLKO.1 1144 CDS 100% 4.950 3.465 N ALDH1A2 n/a
9 TRCN0000220350 CGATGGATGAAGTTATCGAAA pLKO.1 1350 CDS 100% 4.950 3.465 N ALDH1A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003888.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07315 pDONR223 100% 92.5% 92.4% None 16A>C;682_795del n/a
2 ccsbBroad304_07315 pLX_304 0% 92.5% 92.4% V5 16A>C;682_795del n/a
3 TRCN0000481330 ACATTGTCCTTTTTTCCTCAGGTT pLX_317 31% 92.5% 92.4% V5 16A>C;682_795del n/a
Download CSV