Transcript: Human NM_004560.4

Homo sapiens receptor tyrosine kinase like orphan receptor 2 (ROR2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ROR2 (4920)
Length:
4158
CDS:
266..3097

Additional Resources:

NCBI RefSeq record:
NM_004560.4
NBCI Gene record:
ROR2 (4920)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004560.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001491 CCGCTACCATCAGTGCTATAA pLKO.1 1198 CDS 100% 13.200 18.480 N ROR2 n/a
2 TRCN0000199888 GCCCGATTCCAACTCTGAAAG pLKO.1 420 CDS 100% 10.800 15.120 N ROR2 n/a
3 TRCN0000199896 GCGGATCATCATCCGGAAGAC pLKO.1 586 CDS 100% 0.135 0.189 N ROR2 n/a
4 TRCN0000195390 CATTGGCAACCGGACCATTTA pLKO.1 820 CDS 100% 13.200 9.240 N ROR2 n/a
5 TRCN0000196815 GAATCATGTACAGAGCTTAAA pLKO.1 3873 3UTR 100% 13.200 9.240 N ROR2 n/a
6 TRCN0000196919 GTTTGCATGTGCCGGAATAAG pLKO.1 1538 CDS 100% 13.200 9.240 N ROR2 n/a
7 TRCN0000195711 CAACGGGATGAAGACCATTAC pLKO.1 679 CDS 100% 10.800 7.560 N ROR2 n/a
8 TRCN0000010625 GCACAGCCCAAATCATAACTT pLKO.1 736 CDS 100% 5.625 3.938 N ROR2 n/a
9 TRCN0000195328 CCATCATGTACGGCAAGTTCT pLKO.1 2253 CDS 100% 4.950 3.465 N ROR2 n/a
10 TRCN0000001492 CGACAAGCTGAACGTGAAGAT pLKO.1 2137 CDS 100% 4.950 3.465 N ROR2 n/a
11 TRCN0000001490 GCAGCTTCACTCCATGTCATA pLKO.1 3423 3UTR 100% 4.950 3.465 N ROR2 n/a
12 TRCN0000001493 CCTCATTAACCAGCACAAACA pLKO.1 1630 CDS 100% 4.950 2.970 N ROR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004560.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14723 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14723 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000488947 CGATCGTAGGTGGCGTAATTTGCC pLX_317 10.2% 99.8% 99.8% V5 (many diffs) n/a
4 TRCN0000488712 CGTTCACTCCCAGTCATCTCGGTA pLX_317 10.5% 99.6% 99.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000468826 CCGGTGATCATTTAGCTCTCAGGT pLX_317 15.5% 99.6% 99.2% V5 (many diffs) n/a
6 TRCN0000488734 ATCCTGCTGGTAACCGGCATACCT pLX_317 18.7% 52.8% 52.9% V5 (not translated due to prior stop codon) 1_1332del;2088C>T n/a
Download CSV