Transcript: Human NM_004951.5

Homo sapiens G protein-coupled receptor 183 (GPR183), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GPR183 (1880)
Length:
1685
CDS:
79..1164

Additional Resources:

NCBI RefSeq record:
NM_004951.5
NBCI Gene record:
GPR183 (1880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004951.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356878 ACCGCTTTGCCTACACGAATA pLKO_005 322 CDS 100% 10.800 15.120 N GPR183 n/a
2 TRCN0000356942 TACTAGCCTTGGTCGTCATTG pLKO_005 227 CDS 100% 10.800 15.120 N GPR183 n/a
3 TRCN0000221118 GCCTACACGAATAGCCTACTA pLKO.1 330 CDS 100% 4.950 6.930 N GPR183 n/a
4 TRCN0000221115 CCAAAGACATTCGTTCCAGAT pLKO.1 921 CDS 100% 4.050 5.670 N GPR183 n/a
5 TRCN0000221116 CGTGGGAAACTTACTAGCCTT pLKO.1 216 CDS 100% 2.640 3.696 N GPR183 n/a
6 TRCN0000356944 TTGCAGGACTTCCCTTATAAA pLKO_005 1212 3UTR 100% 15.000 10.500 N GPR183 n/a
7 TRCN0000356941 CAGCACGGCCAGGATAGTAAT pLKO_005 159 CDS 100% 13.200 9.240 N GPR183 n/a
8 TRCN0000219433 GCATGGAGTATCCAAACTTTG pLKO.1 620 CDS 100% 10.800 7.560 N Gpr183 n/a
9 TRCN0000221117 CCTGAGTATTGACCGCTTCAT pLKO.1 450 CDS 100% 4.950 3.465 N GPR183 n/a
10 TRCN0000221114 GCAAACAACATAAAGCACAAT pLKO.1 1335 3UTR 100% 4.950 3.465 N GPR183 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004951.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00473 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00473 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479853 CGTACCAGTCTACACCCGTCGTGG pLX_317 37.1% 100% 100% V5 n/a
4 TRCN0000487905 GGGGTTCAGCCTTTAGCCCAACGC pLX_317 29% 99.9% 100% V5 (not translated due to prior stop codon) 222G>T n/a
Download CSV