Transcript: Human NM_005482.3

Homo sapiens phosphatidylinositol glycan anchor biosynthesis class K (PIGK), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PIGK (10026)
Length:
4601
CDS:
29..1216

Additional Resources:

NCBI RefSeq record:
NM_005482.3
NBCI Gene record:
PIGK (10026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050120 CGCTACAATGAGCTACTGTTT pLKO.1 611 CDS 100% 4.950 6.930 N PIGK n/a
2 TRCN0000288941 CGCTACAATGAGCTACTGTTT pLKO_005 611 CDS 100% 4.950 6.930 N PIGK n/a
3 TRCN0000050118 GCAACTGCTTAATGGCACTAA pLKO.1 1386 3UTR 100% 4.950 6.930 N PIGK n/a
4 TRCN0000288943 GCAACTGCTTAATGGCACTAA pLKO_005 1386 3UTR 100% 4.950 6.930 N PIGK n/a
5 TRCN0000050121 GCAGATGATATGGCCTGTAAT pLKO.1 287 CDS 100% 13.200 10.560 N PIGK n/a
6 TRCN0000288942 GCAGATGATATGGCCTGTAAT pLKO_005 287 CDS 100% 13.200 10.560 N PIGK n/a
7 TRCN0000050122 GCTAGTCATATCGAGGATCAA pLKO.1 107 CDS 100% 4.950 3.465 N PIGK n/a
8 TRCN0000288944 GCTAGTCATATCGAGGATCAA pLKO_005 107 CDS 100% 4.950 3.465 N PIGK n/a
9 TRCN0000050119 GCTCAGATAATACACCAGAAA pLKO.1 1082 CDS 100% 4.950 3.465 N PIGK n/a
10 TRCN0000288940 GCTCAGATAATACACCAGAAA pLKO_005 1082 CDS 100% 4.950 3.465 N PIGK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02295 pDONR223 100% 99.9% 100% None 372C>T n/a
2 ccsbBroad304_02295 pLX_304 0% 99.9% 100% V5 372C>T n/a
3 TRCN0000474584 CCTTCTCAATAACCGTTGCATTTT pLX_317 46.8% 99.9% 100% V5 372C>T n/a
4 ccsbBroadEn_11448 pDONR223 100% 83.5% 83% None (many diffs) n/a
5 ccsbBroad304_11448 pLX_304 0% 83.5% 83% V5 (many diffs) n/a
6 TRCN0000468670 GCAATACCGTGGGACACTGAGCCT pLX_317 31.7% 83.5% 83% V5 (many diffs) n/a
Download CSV