Transcript: Human NM_006895.3

Homo sapiens histamine N-methyltransferase (HNMT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
HNMT (3176)
Length:
3132
CDS:
20..898

Additional Resources:

NCBI RefSeq record:
NM_006895.3
NBCI Gene record:
HNMT (3176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413319 AGTGATTGAGGCATAACTATC pLKO_005 883 CDS 100% 10.800 15.120 N HNMT n/a
2 TRCN0000036429 CCAGGCATAATAGGAAGGATT pLKO.1 140 CDS 100% 4.950 6.435 N HNMT n/a
3 TRCN0000036432 CGGGAAATATGTTGAATCTTT pLKO.1 55 CDS 100% 5.625 4.500 N HNMT n/a
4 TRCN0000420988 ATCACAAACTCATCCATTAAT pLKO_005 972 3UTR 100% 15.000 10.500 N HNMT n/a
5 TRCN0000434933 CAATGCTAAGATGCTCATTAT pLKO_005 511 CDS 100% 13.200 9.240 N HNMT n/a
6 TRCN0000416406 CTGGACAACCTAGGGCTTAAG pLKO_005 641 CDS 100% 10.800 7.560 N HNMT n/a
7 TRCN0000036433 GACTGCTTTATTGATGGTAAT pLKO.1 701 CDS 100% 10.800 7.560 N HNMT n/a
8 TRCN0000036430 GCCTGAATTTAGTGCTAAGAA pLKO.1 823 CDS 100% 5.625 3.938 N HNMT n/a
9 TRCN0000036431 CCCAGGAGTTTGTATCAACAA pLKO.1 253 CDS 100% 4.950 3.465 N HNMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06386 pDONR223 100% 99.8% 99.6% None 700A>G n/a
2 ccsbBroad304_06386 pLX_304 0% 99.8% 99.6% V5 700A>G n/a
3 TRCN0000473124 TTGAGCATGCCAGGCCTTCGGCCT pLX_317 46.6% 99.8% 99.6% V5 700A>G n/a
4 ccsbBroadEn_15448 pDONR223 0% 16.5% 15.7% None (many diffs) n/a
5 ccsbBroad304_15448 pLX_304 0% 16.5% 15.7% V5 (many diffs) n/a
6 TRCN0000473500 ATTCCCCAGCCCCATTGAGTCACT pLX_317 100% 16.5% 15.7% V5 (many diffs) n/a
Download CSV