Transcript: Mouse NM_007855.3

Mus musculus twist basic helix-loop-helix transcription factor 2 (Twist2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Twist2 (13345)
Length:
1335
CDS:
167..649

Additional Resources:

NCBI RefSeq record:
NM_007855.3
NBCI Gene record:
Twist2 (13345)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235773 CCCGCATACTCCTGTTCTTTA pLKO_005 1150 3UTR 100% 13.200 18.480 N Twist2 n/a
2 TRCN0000020869 CGACGAGATGGACAATAAGAT pLKO.1 535 CDS 100% 5.625 7.875 N TWIST2 n/a
3 TRCN0000274900 CGACGAGATGGACAATAAGAT pLKO_005 535 CDS 100% 5.625 7.875 N TWIST2 n/a
4 TRCN0000020873 CTTCTCCGTGTGGCGCATGGA pLKO.1 598 CDS 100% 0.000 0.000 N TWIST2 n/a
5 TRCN0000274837 CTTCTCCGTGTGGCGCATGGA pLKO_005 598 CDS 100% 0.000 0.000 N TWIST2 n/a
6 TRCN0000086083 GCATTCTTGTAGAACCTGTTT pLKO.1 1040 3UTR 100% 4.950 3.960 N Twist2 n/a
7 TRCN0000257292 AGCGACGAGATGGACAATAAG pLKO_005 533 CDS 100% 13.200 9.240 N Twist2 n/a
8 TRCN0000086084 GAGCGACGAGATGGACAATAA pLKO.1 532 CDS 100% 13.200 9.240 N Twist2 n/a
9 TRCN0000086085 AGCAAGAAATCGAGCGAAGAT pLKO.1 272 CDS 100% 4.950 3.465 N Twist2 n/a
10 TRCN0000244316 TAGACTTCCTCTACCAGGTTC pLKO_005 507 CDS 100% 4.050 2.835 N Twist2 n/a
11 TRCN0000020872 TGGACAATAAGATGACCAGCT pLKO.1 543 CDS 100% 2.160 1.512 N TWIST2 n/a
12 TRCN0000086086 CCAGTCGCTCAACGAGGCCTT pLKO.1 403 CDS 100% 0.000 0.000 N Twist2 n/a
13 TRCN0000235774 CAAGATCCAGACGCTCAAGCT pLKO_005 472 CDS 100% 2.640 1.584 N Twist2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04728 pDONR223 100% 96.6% 100% None (many diffs) n/a
2 ccsbBroad304_04728 pLX_304 0% 96.6% 100% V5 (many diffs) n/a
3 TRCN0000481002 GGCGATAGTGGCGGATACCTGCGC pLX_317 67.8% 96.6% 100% V5 (many diffs) n/a
Download CSV