Transcript: Mouse NM_008177.3

Mus musculus gastrin releasing peptide receptor (Grpr), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Grpr (14829)
Length:
2582
CDS:
440..1594

Additional Resources:

NCBI RefSeq record:
NM_008177.3
NBCI Gene record:
Grpr (14829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027806 CCCTGCAGTTTATGGGCTTAT pLKO.1 571 CDS 100% 10.800 8.640 N Grpr n/a
2 TRCN0000027802 CCAACCAAACCTTCATTAGTT pLKO.1 1008 CDS 100% 5.625 3.938 N Grpr n/a
3 TRCN0000027765 GCAGTTCAACACTCAACTTCT pLKO.1 1435 CDS 100% 4.950 3.465 N Grpr n/a
4 TRCN0000027823 CTACTACTTCATTGCCCGAAA pLKO.1 1129 CDS 100% 4.050 2.835 N Grpr n/a
5 TRCN0000027788 GACAGGTACAAAGCCATTGTA pLKO.1 851 CDS 100% 0.563 0.394 N Grpr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06329 pDONR223 100% 87.5% 89.8% None (many diffs) n/a
2 ccsbBroad304_06329 pLX_304 0% 87.5% 89.8% V5 (many diffs) n/a
3 TRCN0000480540 TCCTACTGCTGTGGTGGATACCCA pLX_317 33.3% 87.5% 89.8% V5 (many diffs) n/a
4 TRCN0000492074 TCAGCGTCTGACGCAACTTATGAA pLX_317 36.8% 87.5% 89.8% V5 (many diffs) n/a
5 TRCN0000489608 GCGAAAGTCGAATTCATGGGCTAT pLX_317 33.4% 87.5% 89.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV