Transcript: Mouse NM_008292.4

Mus musculus hydroxysteroid (17-beta) dehydrogenase 4 (Hsd17b4), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Hsd17b4 (15488)
Length:
2685
CDS:
152..2359

Additional Resources:

NCBI RefSeq record:
NM_008292.4
NBCI Gene record:
Hsd17b4 (15488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008292.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436293 TACGGAGCTGCAGAGTATTAT pLKO_005 1165 CDS 100% 15.000 21.000 N Hsd17b4 n/a
2 TRCN0000437563 CAACTTTGGCCAGGCGAATTA pLKO_005 622 CDS 100% 13.200 18.480 N Hsd17b4 n/a
3 TRCN0000041630 GCCAATTACGATTCAGTTGAA pLKO.1 362 CDS 100% 4.950 6.930 N Hsd17b4 n/a
4 TRCN0000419559 ATCAAGATTCAAGGCGATTAA pLKO_005 1807 CDS 100% 13.200 10.560 N Hsd17b4 n/a
5 TRCN0000423987 CAGTACTTGGAGCTGTATAAG pLKO_005 1373 CDS 100% 13.200 9.240 N Hsd17b4 n/a
6 TRCN0000427015 GTGCTGTTAAAGGAGTCAATA pLKO_005 2373 3UTR 100% 13.200 9.240 N Hsd17b4 n/a
7 TRCN0000438048 TACACATTGACCCGGACTTTG pLKO_005 1689 CDS 100% 10.800 7.560 N Hsd17b4 n/a
8 TRCN0000041628 GCAGCAGAAATCGCTTCACAT pLKO.1 2448 3UTR 100% 4.950 3.465 N Hsd17b4 n/a
9 TRCN0000041631 GCTGTCATTCAACTTTGCAAA pLKO.1 1336 CDS 100% 4.950 3.465 N Hsd17b4 n/a
10 TRCN0000041629 CCATATTACATGGACTATGTA pLKO.1 1734 CDS 100% 0.563 0.394 N Hsd17b4 n/a
11 TRCN0000246133 TGATGAAGACTGGGATATAAT pLKO_005 487 CDS 100% 15.000 9.000 N HSD17B4 n/a
12 TRCN0000041632 GCAGGAAGAACAACATTCATT pLKO.1 696 CDS 100% 5.625 3.375 N Hsd17b4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008292.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00793 pDONR223 100% 84.8% 86.2% None (many diffs) n/a
2 ccsbBroad304_00793 pLX_304 0% 84.8% 86.2% V5 (many diffs) n/a
3 TRCN0000467393 CTCCCACTTTAGCCATCCTACATA pLX_317 19.7% 84.8% 86.2% V5 (many diffs) n/a
Download CSV