Transcript: Mouse NM_008551.2

Mus musculus MAP kinase-activated protein kinase 2 (Mapkapk2), mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Mapkapk2 (17164)
Length:
2884
CDS:
319..1479

Additional Resources:

NCBI RefSeq record:
NM_008551.2
NBCI Gene record:
Mapkapk2 (17164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232383 TTTGACCACTCCGTGTTATAC pLKO_005 933 CDS 100% 13.200 18.480 N Mapkapk2 n/a
2 TRCN0000232385 TAGATCCAGAGCCAGGTAATT pLKO_005 2140 3UTR 100% 13.200 9.240 N Mapkapk2 n/a
3 TRCN0000232381 TCGATGGTGGAGAGCTCTTTA pLKO_005 698 CDS 100% 13.200 9.240 N Mapkapk2 n/a
4 TRCN0000232382 ACCTGCACTCGATCAACATTG pLKO_005 803 CDS 100% 10.800 7.560 N Mapkapk2 n/a
5 TRCN0000024330 CCGGGCATGAAGACTCGTATT pLKO.1 1093 CDS 100% 10.800 7.560 N Mapkapk2 n/a
6 TRCN0000232384 CCGGGCATGAAGACTCGTATT pLKO_005 1093 CDS 100% 10.800 7.560 N Mapkapk2 n/a
7 TRCN0000024331 TCCGTGTTATACACCATACTA pLKO.1 942 CDS 100% 5.625 3.938 N Mapkapk2 n/a
8 TRCN0000024329 GATGTCTATGAGAACCTGTAT pLKO.1 640 CDS 100% 4.950 3.465 N Mapkapk2 n/a
9 TRCN0000024333 TCGACAAGAGAACCCAGCAAA pLKO.1 521 CDS 100% 4.950 3.465 N Mapkapk2 n/a
10 TRCN0000024332 CCAGAGAATGACCATCACAGA pLKO.1 1209 CDS 100% 2.640 1.848 N Mapkapk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14935 pDONR223 100% 87.7% 31.3% None (many diffs) n/a
2 ccsbBroad304_14935 pLX_304 0% 87.7% 31.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470986 GCGGATCGTTTCACATTGGTTTGT pLX_317 36.2% 87.7% 31.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_07381 pDONR223 100% 86.3% 92.7% None (many diffs) n/a
5 ccsbBroad304_07381 pLX_304 0% 86.3% 92.7% V5 (many diffs) n/a
6 TRCN0000476256 ATCCGTGCATGCCAGTGTACTACA pLX_317 30.8% 86.3% 92.7% V5 (many diffs) n/a
7 TRCN0000489713 AGGCAGTCTCACCTTTAGTACACT pLX_317 30.7% 79.5% 83.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV