Transcript: Mouse NM_008601.3

Mus musculus microphthalmia-associated transcription factor (Mitf), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Mitf (17342)
Length:
4581
CDS:
139..1398

Additional Resources:

NCBI RefSeq record:
NM_008601.3
NBCI Gene record:
Mitf (17342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305603 TAACATAAACGACCGCATTAA pLKO_005 792 CDS 100% 13.200 18.480 N Mitf n/a
2 TRCN0000095288 GCAAATACGTTACCCGTCTCT pLKO.1 571 CDS 100% 2.640 3.696 N Mitf n/a
3 TRCN0000095287 CCTATGGCTATGCTCACTCTT pLKO.1 358 CDS 100% 4.950 3.960 N Mitf n/a
4 TRCN0000095284 GCCAGACTTGTATATTCTATT pLKO.1 1558 3UTR 100% 13.200 9.240 N Mitf n/a
5 TRCN0000323677 GCCAGACTTGTATATTCTATT pLKO_005 1558 3UTR 100% 13.200 9.240 N Mitf n/a
6 TRCN0000305604 GGGAGCTCACAGCGTGTATTT pLKO_005 686 CDS 100% 13.200 9.240 N Mitf n/a
7 TRCN0000329866 GGGAGCTCACAGCGTGTATTT pLKO_005 686 CDS 100% 13.200 9.240 N MITF n/a
8 TRCN0000362601 TATGGCTATGCTCACTCTTAA pLKO_005 360 CDS 100% 13.200 9.240 N Mitf n/a
9 TRCN0000362536 TCAGCCTGGAATCAAGTTATA pLKO_005 509 CDS 100% 13.200 9.240 N Mitf n/a
10 TRCN0000095286 CGGTGGAACAAGGGAACCATT pLKO.1 856 CDS 100% 4.950 3.465 N Mitf n/a
11 TRCN0000095285 GCAGTACCTTTCTACCACTTT pLKO.1 237 CDS 100% 4.950 3.465 N Mitf n/a
12 TRCN0000323608 GCAGTACCTTTCTACCACTTT pLKO_005 237 CDS 100% 4.950 3.465 N Mitf n/a
13 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1848 3UTR 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01017 pDONR223 100% 86.9% 92.6% None (many diffs) n/a
2 ccsbBroad304_01017 pLX_304 0% 86.9% 92.6% V5 (many diffs) n/a
3 TRCN0000469674 TTCGCAATTCTTGTCATTTGACGT pLX_317 40.3% 86.9% 92.6% V5 (many diffs) n/a
4 ccsbBroadEn_06583 pDONR223 100% 20.2% 20% None (many diffs) n/a
5 ccsbBroad304_06583 pLX_304 0% 20.2% 20% V5 (many diffs) n/a
6 TRCN0000475375 ACCGGCGCAAAGTGGTACCTTATT pLX_317 100% 20.2% 20% V5 (many diffs) n/a
Download CSV