Transcript: Mouse NM_008774.3

Mus musculus poly(A) binding protein, cytoplasmic 1 (Pabpc1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pabpc1 (18458)
Length:
2842
CDS:
468..2378

Additional Resources:

NCBI RefSeq record:
NM_008774.3
NBCI Gene record:
Pabpc1 (18458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161364 GAACCTTATGTACCGAGCAAA pLKO.1 2509 3UTR 100% 4.950 6.930 N PABPC3 n/a
2 TRCN0000278578 GAACCTTATGTACCGAGCAAA pLKO_005 2509 3UTR 100% 4.950 6.930 N PABPC3 n/a
3 TRCN0000054948 CCATCGACAATAAAGCACTAT pLKO.1 793 CDS 100% 4.950 3.465 N Pabpc1 n/a
4 TRCN0000331981 CCATCGACAATAAAGCACTAT pLKO_005 793 CDS 100% 4.950 3.465 N Pabpc1 n/a
5 TRCN0000054950 GCTGTTCATGTGCAAGGTCAA pLKO.1 2073 CDS 100% 4.050 2.835 N Pabpc1 n/a
6 TRCN0000309680 GCTGTTCATGTGCAAGGTCAA pLKO_005 2073 CDS 100% 4.050 2.835 N Pabpc1 n/a
7 TRCN0000054949 CCAAAGGATTTGGATTTGTAA pLKO.1 1156 CDS 100% 5.625 3.375 N Pabpc1 n/a
8 TRCN0000160452 CCAAAGGATTTGGATTTGTAA pLKO.1 1156 CDS 100% 5.625 3.375 N PABPC3 n/a
9 TRCN0000054951 CGTGCTTTGGACACCATGAAT pLKO.1 666 CDS 100% 5.625 3.375 N Pabpc1 n/a
10 TRCN0000309753 CGTGCTTTGGACACCATGAAT pLKO_005 666 CDS 100% 5.625 3.375 N Pabpc1 n/a
11 TRCN0000159954 GAAAGGAAACTTTGAACCTTA pLKO.1 2496 3UTR 100% 4.950 2.970 N PABPC3 n/a
12 TRCN0000297494 GAAAGGAAACTTTGAACCTTA pLKO_005 2496 3UTR 100% 4.950 2.970 N PABPC3 n/a
13 TRCN0000054952 CCTAGCCAAATTGCTCAACTA pLKO.1 1740 CDS 100% 4.950 2.475 Y Pabpc1 n/a
14 TRCN0000309752 CCTAGCCAAATTGCTCAACTA pLKO_005 1740 CDS 100% 4.950 2.475 Y Pabpc1 n/a
15 TRCN0000161683 GCCACTAAAGCAGTTACAGAA pLKO.1 1503 CDS 100% 4.950 3.465 N PABPC3 n/a
16 TRCN0000278524 GCCACTAAAGCAGTTACAGAA pLKO_005 1503 CDS 100% 4.950 3.465 N PABPC3 n/a
17 TRCN0000074640 CCAGACCTCATCCATTCCAAA pLKO.1 1792 CDS 100% 4.950 2.970 N PABPC1 n/a
18 TRCN0000166200 CCAGACCTCATCCATTCCAAA pLKO.1 1792 CDS 100% 4.950 2.970 N PABPC3 n/a
19 TRCN0000286207 CCAGACCTCATCCATTCCAAA pLKO_005 1792 CDS 100% 4.950 2.970 N PABPC1 n/a
20 TRCN0000160450 CAGAATTACTTCACATGCTAT pLKO.1 2239 CDS 100% 4.950 2.970 N LRRC4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06682 pDONR223 100% 90.8% 91.6% None (many diffs) n/a
2 ccsbBroad304_06682 pLX_304 0% 90.8% 91.6% V5 (many diffs) n/a
3 ccsbBroadEn_10408 pDONR223 100% 36.7% 32.7% None (many diffs) n/a
4 ccsbBroad304_10408 pLX_304 0% 36.7% 32.7% V5 (many diffs) n/a
Download CSV